
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
si:busm1-199m19.4
- Ensembl ID:
- ENSDARG00000017431
- ZFIN ID:
- ZDB-GENE-030616-328
- Description:
- Novel protein [Source:UniProtKB/TrEMBL;Acc:Q801X0]
- Human Orthologue:
- FAM63B
- Human Description:
- family with sequence similarity 63, member B [Source:HGNC Symbol;Acc:26954]
- Mouse Orthologue:
- Fam63b
- Mouse Description:
- family with sequence similarity 63, member B Gene [Source:MGI Symbol;Acc:MGI:2443086]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa16284 | Nonsense | Available for shipment | Available now |
sa20976 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa16284
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000027466 | Nonsense | 193 | 625 | 1 | 9 |
- Genomic Location (Zv9):
- Chromosome 7 (position 31830770)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 7 30223112 GRCz11 7 30494262 - KASP Assay ID:
- 2259-8984.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- GAGTCCCGCAGCTTTGATTCACTCGAGTCCTTCTCCAACCTGAACTCCTG[T/A]CCGAGTTCAGACCTCAACAGTGAAGGACTGGAGGAGAAGGGACTGGCTTT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa20976
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000027466 | Nonsense | 291 | 625 | 2 | 9 |
- Genomic Location (Zv9):
- Chromosome 7 (position 31834837)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 7 30227179 GRCz11 7 30498329 - KASP Assay ID:
- 2259-8985.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AAGCTGCCACCAATGATGGAAATGATAACGGCAGAGCAGCTGATGGAATA[T/A]CTGGGTGAGCATTTCATTTGCATCACAATTGTGGATTTTCTTGACATGGT
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: