sphkap

Ensembl ID:
ENSDARG00000017429
ZFIN ID:
ZDB-GENE-050419-32
Description:
A-kinase anchor protein SPHKAP [Source:UniProtKB/Swiss-Prot;Acc:Q1LV19]
Human Orthologue:
SPHKAP
Human Description:
SPHK1 interactor, AKAP domain containing [Source:HGNC Symbol;Acc:30619]
Mouse Orthologue:
Sphkap
Mouse Description:
SPHK1 interactor, AKAP domain containing Gene [Source:MGI Symbol;Acc:MGI:1924879]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17815 Nonsense Available for shipment Available now
sa36731 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa17815
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040669 Nonsense 596 1596 7 12
Genomic Location (Zv9):
Chromosome 18 (position 44827945)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 46421474
GRCz11 18 46419492
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCACACATWACAAGATAGTGGATGGCATCAMAAATCCAAGAAGACCGTAT[C/T]AGGAGCAACAAGATGTGGATAACTTCACTCAAGAAATATCWGACAGTATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36731
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040669 Nonsense 856 1596 7 12
Genomic Location (Zv9):
Chromosome 18 (position 44827165)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 46420694
GRCz11 18 46418712
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCATGGCTACAGAGCTGGCAGCGATATGCTTGGAGAACTCAAGTGGAAAG[C/T]AGCCGTGGTTCTGCGCATTAAATGGTGGCTCGGAAGGTCCAGAAGGGCTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link