si:dkey-97i18.2

Ensembl ID:
ENSDARG00000017427
ZFIN ID:
ZDB-GENE-030131-5837
Description:
Wu:fi20g04 protein [Source:UniProtKB/TrEMBL;Acc:Q7ZVG2]
Human Orthologue:
PHF20L1
Human Description:
PHD finger protein 20-like 1 [Source:HGNC Symbol;Acc:24280]
Mouse Orthologue:
Phf20l1
Mouse Description:
PHD finger protein 20-like 1 Gene [Source:MGI Symbol;Acc:MGI:2444412]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa39110 Essential Splice Site Mutation detected in F1 DNA During 2018
sa13222 Essential Splice Site Available for shipment Available now
sa36181 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa39110
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002930 Essential Splice Site None 1116 1 24
ENSDART00000105158 Essential Splice Site None 673 1 18
ENSDART00000115266   None 1114 None 24
ENSDART00000137311 Essential Splice Site None 209 1 8
Genomic Location (Zv9):
Chromosome 16 (position 33926890)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 31664790
GRCz11 16 31622717
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACAATACACTATAGGAATTAATTGCTATTCTCTCAATGAATTTGCAAAG[G/A]TAAATCTACATGTCACGCATACAGCGGAGGTCAGAAAGCAACTGTCATTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13222
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002930 Essential Splice Site None 1116 None 24
ENSDART00000105158 Essential Splice Site None 673 None 18
ENSDART00000115266   None 1114 None 24
ENSDART00000137311 Essential Splice Site None 209 None 8
Genomic Location (Zv9):
Chromosome 16 (position 33926889)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 31664789
GRCz11 16 31622716
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACAATACACTATAGGAATTAATTGCTATTCTCTCAATGAAWTTGCAAAGG[T/A]AAATCTACWTGTCACKCATACAGCGGAGGTCAGAAAGCAACTGTCATTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36181
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002930 Essential Splice Site 871 1116 21 24
ENSDART00000105158   None 673 None 18
ENSDART00000115266 Essential Splice Site 869 1114 20 24
ENSDART00000137311   None 209 None 8
Genomic Location (Zv9):
Chromosome 16 (position 33912352)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 31650252
GRCz11 16 31608179
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTAAACTGAAATGTCTCCAGATTTGTTACTAAAATATGCTCTTTTCTCA[G/T]GTCAGAGGTGGAGCGCAAAGTACCGCCATGATAAAGACTGGCTTCAAAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link