zgc:55343

Ensembl ID:
ENSDARG00000017407
ZFIN ID:
ZDB-GENE-040426-697
Description:
tubulin--tyrosine ligase-like protein 12 [Source:RefSeq peptide;Acc:NP_956546]
Human Orthologue:
TTLL12
Human Description:
tubulin tyrosine ligase-like family, member 12 [Source:HGNC Symbol;Acc:28974]
Mouse Orthologue:
Ttll12
Mouse Description:
tubulin tyrosine ligase-like family, member 12 Gene [Source:MGI Symbol;Acc:MGI:3039573]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa38158 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa38158
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023846 Nonsense 200 625 4 14
Genomic Location (Zv9):
Chromosome Zv9_scaffold3512 (position 50447)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 8774572
GRCz11 4 8775488
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCACTCTTCACAGCCGACTTGCTGTATGGCTCCTCTGTTTTACGCTCCG[C/T]AACAGATTGCTTATTCTGTGCTGTGGCCACTGCAGAACCTGGAATATGGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link