smarcc1a

Ensembl ID:
ENSDARG00000017397
ZFIN ID:
ZDB-GENE-080514-3
Description:
Smarcc1 protein [Source:UniProtKB/TrEMBL;Acc:Q7ZUU5]
Human Orthologue:
SMARCC1
Human Description:
SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily c, member 1 [S
Mouse Orthologue:
Smarcc1
Mouse Description:
SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily c, member 1 Ge

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16518 Nonsense Available for shipment Available now
sa22926 Essential Splice Site Available for shipment Available now
sa36232 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa16518
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109259 Nonsense 482 1089 16 28
Genomic Location (Zv9):
Chromosome 16 (position 45216859)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 42541942
GRCz11 16 42445700
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTCATGTTTGTTTTGCTGTCTAAATTGCYTTTTCTCTTATTTGTAGTTA[T/A]CTTGCCTATCGTAACTTCATGATTGACAMTTACCGGCTGAATCCTCAGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22926
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109259 Essential Splice Site 886 1089 24 28
Genomic Location (Zv9):
Chromosome 16 (position 45202243)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 42527326
GRCz11 16 42431084
KASP Assay ID:
2261-0202.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGCCACCGCTGCAGCCGCCGCTCTGGCCTCTGCCGCCACCAAGGCAAAGG[T/A]AAAGCATTCAGACTGCAATGTTTAGCAGTTCTTGAACTTCCTCTGGTGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36232
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109259 Nonsense 974 1089 26 28
Genomic Location (Zv9):
Chromosome 16 (position 45199603)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 42524686
GRCz11 16 42428444
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGCCCGTCAGCAGATGGAGCAGCAGGCAGCGGTGCAGCAAAACGCTGGA[G/T]GACATCATGGTCCTCCTCCACATGGACCACCTCCAGGCATGCACCCTGGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link