
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
cdkl1
- Ensembl ID:
- ENSDARG00000017329
- ZFIN ID:
- ZDB-GENE-040808-34
- Description:
- Cyclin-dependent kinase-like 1 [Source:UniProtKB/Swiss-Prot;Acc:Q6AXJ9]
- Human Orthologue:
- CDKL1
- Human Description:
- cyclin-dependent kinase-like 1 (CDC2-related kinase) [Source:HGNC Symbol;Acc:1781]
- Mouse Orthologue:
- Cdkl1
- Mouse Description:
- cyclin-dependent kinase-like 1 (CDC2-related kinase) Gene [Source:MGI Symbol;Acc:MGI:1918341]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa38962 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa31949 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa38962
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000044357 | Nonsense | 227 | 350 | 7 | 10 |
- Genomic Location (Zv9):
- Chromosome 13 (position 37097595)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 13 36569897 GRCz11 13 36695729 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AATTATGGTTTAATGTTGTGCTCATAGGTGAGTTGATTCCTCGACATCAA[C/T]AGGTGTTCAGCACCAACCAGTTCTTTAGCGGCGTTTGTGTGCCTGAGCCA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa31949
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000044357 | Nonsense | 284 | 350 | 9 | 10 |
- Genomic Location (Zv9):
- Chromosome 13 (position 37097260)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 13 36569562 GRCz11 13 36695394 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GTCTGCGGATGGATCCGGCTGAGAGGTTGTCCTGTGAGCAGTTACTGGAA[C/T]AGCCCTACTTTGACAGTCTGCGAGAGGAGAGCGAGAGTGTGACGCGTGAA
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Cognitive performance: Common genetic variation and performance on standardized cognitive tests. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: