zgc:92041

Ensembl ID:
ENSDARG00000017314
ZFIN ID:
ZDB-GENE-040808-55
Description:
hypothetical protein LOC445282 [Source:RefSeq peptide;Acc:NP_001003737]
Human Orthologue:
CELA1
Human Description:
chymotrypsin-like elastase family, member 1 [Source:HGNC Symbol;Acc:3308]
Mouse Orthologue:
Cela1
Mouse Description:
chymotrypsin-like elastase family, member 1 Gene [Source:MGI Symbol;Acc:MGI:95314]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa43764 Nonsense Mutation detected in F1 DNA During 2018
sa37421 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa43764
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021594 Nonsense 176 266 6 8
ENSDART00000063389   None 120 None 4

The following transcripts of ENSDARG00000017314 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 22 (position 7481586)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 7413863
GRCz11 22 7443709
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TACTTTATTTCTCTCCTGCAGCTGGTGGCTCCCTCTCCGCTCAGCTGAAA[C/T]AGGCCTATCTGCCCGTGGTCGACTACAATACCTGCTCTCGTGGTGACTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37421
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021594 Essential Splice Site 263 266 7 8
ENSDART00000063389   None 120 None 4

The following transcripts of ENSDARG00000017314 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 22 (position 7481928)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 7414205
GRCz11 22 7444051
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCCAACCGTCTTCACTCGCGTCTCTGCCTACATCAGCTGGATTAATGGC[G/A]TAAGTGCAATTTATGAATTTATATAGTCGTTAAAATAAAGCAATGATGAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link