
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
gnai2
- Ensembl ID:
- ENSDARG00000017294
- ZFIN IDs:
- ZDB-GENE-030131-5861, ZDB-GENE-030131-5861
- Description:
- guanine nucleotide-binding protein G(i) subunit alpha-2 [Source:RefSeq peptide;Acc:NP_956136]
- Human Orthologue:
- GNAI2
- Human Description:
- guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 2 [Source:HGNC
- Mouse Orthologue:
- Gnai2
- Mouse Description:
- guanine nucleotide binding protein (G protein), alpha inhibiting 2 Gene [Source:MGI Symbol;Acc:MGI:9
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa33975 | Essential Splice Site, Missense | Available for shipment | Available now |
sa33974 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa33975
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- T > A
- Consequence:
- Essential Splice Site, Missense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000024181 | Missense | 1 | 322 | 1 | 9 |
ENSDART00000079694 | Essential Splice Site | 26 | 349 | None | 10 |
- Genomic Location (Zv9):
- Chromosome 6 (position 53096256)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 6 53145261 GRCz11 6 53143590 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AAGGCGGCCGCAGAGAGATCAAAGATGATCGACAAAAACCTGCGGGAGGA[T/A]GGAGAGAAGGCGGCGAGGGAGGTGAAGCTGCTCCTGCTCGGTAAGTCACT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa33974
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- A > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000024181 | Nonsense | 263 | 322 | 8 | 9 |
ENSDART00000079694 | Nonsense | 290 | 349 | 9 | 10 |
- Genomic Location (Zv9):
- Chromosome 6 (position 53005412)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 6 53054417 GRCz11 6 53052746 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ACGCACAAGTTCAAATCGATTTTCTGTATTTTGTTGATGCAGGAGCCAAT[A/T]AATACGACGAGGCTGCCAGTTACATCCAGACCAAGTTCGAGGATCTCAAC
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: