
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
si:ch211-67f13.6
- Ensembl ID:
- ENSDARG00000017254
- ZFIN ID:
- ZDB-GENE-090312-78
- Description:
- hypothetical protein LOC561206 [Source:RefSeq peptide;Acc:NP_001139047]
- Human Orthologue:
- KCNK1
- Human Description:
- potassium channel, subfamily K, member 1 [Source:HGNC Symbol;Acc:6272]
- Mouse Orthologue:
- Kcnk1
- Mouse Description:
- potassium channel, subfamily K, member 1 Gene [Source:MGI Symbol;Acc:MGI:109322]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa42252 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa42252
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- A > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000017202 | Nonsense | 57 | 337 | 1 | 3 |
ENSDART00000131858 | Nonsense | 57 | 176 | 1 | 2 |
- Genomic Location (Zv9):
- Chromosome 13 (position 36258318)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 13 35730887 GRCz11 13 35856719 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TGTTTTCCTCGGTGGAGCTGCCGTATGAAGACGACCTTCGCCAGCAGCTC[A/T]GAGAGATAAAGAGACTTTTCCTCCAGGAGCACCAGTGTCTGTCCGAGGAG
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Diabetic retinopathy : Genome-wide meta-analysis for severe diabetic retinopathy. (View Study)
- Periodontal microbiota: Genome-wide association study of periodontal pathogen colonization. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: