strumpellin

Ensembl ID:
ENSDARG00000017190
ZFIN ID:
ZDB-GENE-040426-838
Description:
WASH complex subunit strumpellin [Source:UniProtKB/Swiss-Prot;Acc:Q7ZVM1]
Human Orthologue:
KIAA0196
Human Description:
KIAA0196 [Source:HGNC Symbol;Acc:28984]
Mouse Orthologue:
E430025E21Rik
Mouse Description:
RIKEN cDNA E430025E21 gene Gene [Source:MGI Symbol;Acc:MGI:2146110]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22932 Nonsense Available for shipment Available now
sa28731 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa22932
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005653 Nonsense 134 1021 3 25
Genomic Location (Zv9):
Chromosome 16 (position 46159945)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 43412956
GRCz11 16 43316714
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTATGCTTTATGTCTGCTTATATTTCACTCCCTCCATCCTGCACACACAA[C/T]AGGCCAAGATGAGAGAGATCGTGGACAAATACTTCCCTGACAACTGGGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa28731
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005653 Essential Splice Site 287 1021 6 25
Genomic Location (Zv9):
Chromosome 16 (position 46156358)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 43409369
GRCz11 16 43313127
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTTTCAGCTGCTGCTGGACACGGCTCAGTTTGAGTTCATACTCAAAGAG[G/A]TAAATATAAAAAATTGAATTATTTTGAAATTATATTTCTCAATGTTAAAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link