si:dkey-29p10.4

Ensembl ID:
ENSDARG00000017173
ZFIN ID:
ZDB-GENE-050420-117
Description:
Novel protein similar to vertebrate tripartite motif-containing family [Source:UniProtKB/TrEMBL;Acc:
Human Orthologues:
TRIM16, TRIM16L, TRIM25, TRIM29, TRIM47, TRIM8
Human Descriptions:
tripartite motif-containing 16 [Source:HGNC Symbol;Acc:17241]
tripartite motif-containing 16-like [Source:HGNC Symbol;Acc:32670]
tripartite motif-containing 25 [Source:HGNC Symbol;Acc:12932]
tripartite motif-containing 29 [Source:HGNC Symbol;Acc:17274]
tripartite motif-containing 47 [Source:HGNC Symbol;Acc:19020]
tripartite motif-containing 8 [Source:HGNC Symbol;Acc:15579]
Mouse Orthologues:
4933422H20Rik, Trim16, Trim25, Trim29, Trim47, Trim8
Mouse Descriptions:
RIKEN cDNA 4933422H20 gene Gene [Source:MGI Symbol;Acc:MGI:3588186]
tripartite motif-containing 16 Gene [Source:MGI Symbol;Acc:MGI:2137356]
tripartite motif-containing 25 Gene [Source:MGI Symbol;Acc:MGI:102749]
tripartite motif-containing 29 Gene [Source:MGI Symbol;Acc:MGI:1919419]
tripartite motif-containing 47 Gene [Source:MGI Symbol;Acc:MGI:1917374]
tripartite motif-containing 8 Gene [Source:MGI Symbol;Acc:MGI:1933302]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa36668 Nonsense Mutation detected in F1 DNA During 2018
sa1348 Essential Splice Site Confirmed mutation in F2 line During 2018
sa5911 Essential Splice Site Mutation detected in F1 DNA During 2018
sa5795 Essential Splice Site F2 line generated During 2018
sa9144 Nonsense Mutation detected in F1 DNA During 2018
sa23318 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa36668
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098324 Nonsense 117 560 3 12
ENSDART00000136172 Nonsense 271 717 2 7
Genomic Location (Zv9):
Chromosome 18 (position 27285838)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 27359093
GRCz11 18 27341471
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACTATCAAGAAACAGCTCTGTTCCCTGCCATTACTGTCCCAGTTCAGAA[C/T]AGAAGGTGGCAGTAAAGACCTGCCTGGTTTGTGGGGCATCCATGTGCTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1348
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098324   None 560 None 12
ENSDART00000136172 Essential Splice Site 392 717 3 7
Genomic Location (Zv9):
Chromosome 18 (position 27291716)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 27364971
GRCz11 18 27347349
KASP Assay ID:
554-1262.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCATTCAGGAAAAGGTGTCTGAGCTCAGTGAGAAAAAACATTGTGTTCAG[G/A]TAAGCGTACAAAAATTTTGTTGATTTATCTCTGRAACTTTATYTACTTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5911
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098324 Essential Splice Site 251 560 6 12
ENSDART00000136172   None 717 None 7
Genomic Location (Zv9):
Chromosome 18 (position 27296032)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 27369287
GRCz11 18 27351665
KASP Assay ID:
554-3803.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTTTTTTTCWAGAGCAAACAGGAAACAAATAAAATGACCWTACCTTTCT[G/T]TAAACAAGATAAAATTAAAATTAGGGAGATAGTGAAGCTTATTTTAACAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5795
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098324 Essential Splice Site 261 560 7 12
ENSDART00000136172   None 717 None 7
Genomic Location (Zv9):
Chromosome 18 (position 27296088)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 27369343
GRCz11 18 27351721
KASP Assay ID:
554-3538.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGATAAAATTAAAATTAGGGAGATAGTGAAGCTTATTTTAACAACAAAA[G/T]AAATAATAATTMTAAAAATACAAAAYACTCAGSGAACTAACATGGCTGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9144
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098324 Nonsense 512 560 11 12
ENSDART00000136172 Nonsense 664 717 7 7
Genomic Location (Zv9):
Chromosome 18 (position 27303075)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 27376330
GRCz11 18 27358708
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCACCTGTTTGTGCGACTGATCTCCAGAAAGTCGGGGTGTTGCTGAATT[T/A]RAATGAAGGCAGATTGTYGTTTTATAGTGTGGCCAGAGATGGTGCTCTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23318
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098324 Nonsense 530 560 11 12
ENSDART00000136172 Nonsense 682 717 7 7
Genomic Location (Zv9):
Chromosome 18 (position 27303129)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 27376384
GRCz11 18 27358762
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGAAGGCAGATTGTCGTTTTATAGTGTGGCCAGAGATGGTGCTCTTTCTT[T/A]GCTCTATAGCTTTGAGCACACGTTTAGTGAGCCGCTGTATCCTGCGCTGG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link