slc3a1

Ensembl ID:
ENSDARG00000017165
ZFIN ID:
ZDB-GENE-090313-225
Description:
Novel protein similar to vertebrate SLC3A1 solute carrier family 3 (Cystine, dibasic and neutral ami
Human Orthologue:
SLC3A1
Human Description:
solute carrier family 3 (cystine, dibasic and neutral amino acid transporters, activator of cystine,
Mouse Orthologue:
Slc3a1
Mouse Description:
solute carrier family 3, member 1 Gene [Source:MGI Symbol;Acc:MGI:1195264]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15066 Nonsense Available for shipment Available now
sa2700 Nonsense Available for shipment Available now
sa13805 Nonsense Available for shipment Available now
sa15773 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa15066
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018263 Nonsense 165 674 2 10
ENSDART00000132393 Nonsense 129 638 2 10
Genomic Location (Zv9):
Chromosome 13 (position 10234069)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 10536398
GRCz11 13 10668873
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCGATCTGGATCAGTCCTTTCTACAAGTCTCCTATGAGGGACTTTGGATA[C/A]GAYGTGGAGGATTTCWGAGACGTTGACCCTCTTTTTGGWACAATGGAAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2700
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018263 Nonsense 212 674 3 10
ENSDART00000132393 Nonsense 176 638 3 10
Genomic Location (Zv9):
Chromosome 13 (position 10230556)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 10532885
GRCz11 13 10665360
KASP Assay ID:
554-3034.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGCTGATCATGGACTACATCCCGAAYCACACCAGTGACAAACACGTCTG[G/A]TTTCAGCTTAGCCGTAATTACACAGAGCCCTACACAGACTATTACATCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13805
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018263 Nonsense 212 674 3 10
ENSDART00000132393 Nonsense 176 638 3 10
Genomic Location (Zv9):
Chromosome 13 (position 10230556)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 10532885
GRCz11 13 10665360
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGCTGATCATGGACTACATCCCGAAYCACACCAGTGACAAACACGTCTG[G/A]TTTCAGCTTAGCCGTAATTACACAGAGCCCTACACAGACTATTACATCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15773
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018263 Nonsense 252 674 4 10
ENSDART00000132393 Nonsense 216 638 4 10
Genomic Location (Zv9):
Chromosome 13 (position 10228471)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 10530800
GRCz11 13 10663275
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
YATTGTTTGATTTGTCAGGTGAGTGTTTTCGGGAATTCCACGTGGGAGTA[T/G]RATGAARTACGGSAGCAGTGCTATTTYCATCAGTTCCTCAAGGAACAGCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link