wnt10a

Ensembl ID:
ENSDARG00000017155
ZFIN ID:
ZDB-GENE-990415-278
Description:
Protein Wnt-10a [Source:UniProtKB/Swiss-Prot;Acc:P43446]
Human Orthologue:
WNT10A
Human Description:
wingless-type MMTV integration site family, member 10A [Source:HGNC Symbol;Acc:13829]
Mouse Orthologue:
Wnt10a
Mouse Description:
wingless related MMTV integration site 10a Gene [Source:MGI Symbol;Acc:MGI:108071]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa41363 Nonsense Mutation detected in F1 DNA During 2018
sa12206 Essential Splice Site Available for shipment Available now
sa41364 Nonsense Mutation detected in F1 DNA During 2018
sa31702 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa41363
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007308 Nonsense 147 442 2 4
Genomic Location (Zv9):
Chromosome 9 (position 11657474)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 11410039
GRCz11 9 11381242
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCATGAGTGCCAGCATCAGTTCCGAGGGCACCGCTGGAACTGCTCAAGTT[T/A]GGAGACCAGGAATAAAATCCCTTACGAGAGTGTGGTCTTCAGCAGGGGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12206
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007308 Essential Splice Site 163 442 3 4
Genomic Location (Zv9):
Chromosome 9 (position 11662237)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 11414802
GRCz11 9 11386005
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACTTTTGAAGGCAGCTTGCCTGAATAATCTATTGCATTGTTTCATTGGC[A/G]GGTTTCAGAGAAAGCGCATTTRCTTATGCCATTGCTGCAGCTGGTGTGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41364
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007308 Nonsense 166 442 3 4
Genomic Location (Zv9):
Chromosome 9 (position 11662247)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 11414812
GRCz11 9 11386015
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGCAGCTTGCCTGAATAATCTATTGCATTGTTTCATTGGCAGGTTTCAGA[G/T]AAAGCGCATTTGCTTATGCCATTGCTGCAGCTGGTGTGGTGCATGCCGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31702
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007308 Nonsense 344 442 4 4
Genomic Location (Zv9):
Chromosome 9 (position 11685368)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 11437933
GRCz11 9 11409136
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCGCTTCAACGTGGCCACGCTAATCAAAGCCCACAACAGAAACACAGGT[C/T]AGGTGGAGAATGCCCACCACACACACCGGCGGAGAGCCAACATCAATGAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Hair color: Web-based, participant-driven studies yield novel genetic associations for common traits. (View Study)
  • Hair morphology: Common variants in the trichohyalin gene are associated with straight hair in Europeans. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link