si:dkey-223d9.4

Ensembl ID:
ENSDARG00000017154
ZFIN ID:
ZDB-GENE-090313-249
Human Orthologue:
CABLES2
Human Description:
Cdk5 and Abl enzyme substrate 2 [Source:HGNC Symbol;Acc:16143]
Mouse Orthologues:
Cables2, CT485612.1
Mouse Description:
CDK5 and Abl enzyme substrate 2 Gene [Source:MGI Symbol;Acc:MGI:2182335]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa37619 Essential Splice Site Available for shipment Available now
sa37620 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa37619
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000030811 Essential Splice Site 168 494 2 9
ENSDART00000141474   None 178 None 4
ENSDART00000144643 Essential Splice Site 168 286 2 5
Genomic Location (Zv9):
Chromosome 23 (position 9219703)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 9177844
GRCz11 23 9112814
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATAATTTTCAAACGTGTTTCATTGTTTTACCCAACTGTGTGTGTCCTCA[G/T]GAGCCGGAATGCGTCTGGTTCTCCTCGTCCACGCTCTATGAAGAAAATCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37620
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000030811 Nonsense 299 494 5 9
ENSDART00000141474   None 178 None 4
ENSDART00000144643   None 286 None 5
Genomic Location (Zv9):
Chromosome 23 (position 9230550)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 9188691
GRCz11 23 9123661
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATCTGACTCTACCCCTGCCCTTTTCCAGAAACAGCATCCCTCGCAGTTA[T/A]CCGTCCTCTCGCCTCAACAGCACCGTCGGACTGGACCTGGGTATGATACA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link