brd9

Ensembl ID:
ENSDARG00000017143
ZFIN ID:
ZDB-GENE-060502-1
Description:
Bromodomain-containing protein 9 [Source:UniProtKB/Swiss-Prot;Acc:Q7ZUF2]
Human Orthologue:
BRD9
Human Description:
bromodomain containing 9 [Source:HGNC Symbol;Acc:25818]
Mouse Orthologue:
Brd9
Mouse Description:
bromodomain containing 9 Gene [Source:MGI Symbol;Acc:MGI:2145317]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa42832 Nonsense Mutation detected in F1 DNA During 2018
sa36267 Essential Splice Site Mutation detected in F1 DNA During 2018
sa31009 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa42832
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009256 Nonsense 98 631 3 17
Genomic Location (Zv9):
Chromosome 16 (position 56487787)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 53073744
GRCz11 16 52961518
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACAAATTTTTGCATATTTCATTCAGGAGGAGAAAAAGAAGAAGCGTGAG[C/T]GAGAGCAGTCAGAAACTGCGTCCACTGCACCAGTGGAGCCGTTCACCCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36267
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009256 Essential Splice Site 164 631 4 17
Genomic Location (Zv9):
Chromosome 16 (position 56487509)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 53073466
GRCz11 16 52961240
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTAGAGCAGCCGGCGGACCGGCCCGTACGAGCCTGCAGAACACAGCAAG[G/A]TACAAGTGCAGATCCAAATTATTACAATGGTTGAAGTCAGGATTAGTAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31009
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009256 Essential Splice Site 232 631 6 17
Genomic Location (Zv9):
Chromosome 16 (position 56482754)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 53068711
GRCz11 16 52956485
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAAGGACAAAATCGCTGCAAACGAATACAAAACGATTACAGAATTCAAGG[T/G]TTGTGCATTATTTTATCCTCATTTAGCATCATTCTGTGCAAATGACAGTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link