zgc:63587

Ensembl ID:
ENSDARG00000017140
ZFIN ID:
ZDB-GENE-040426-1175
Description:
hypothetical protein LOC393431 [Source:RefSeq peptide;Acc:NP_956753]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa27129 Essential Splice Site Mutation detected in F1 DNA During 2018
sa6135 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa27129
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019828 Essential Splice Site 113 276 5 9
Genomic Location (Zv9):
Chromosome 8 (position 4882634)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 4618608
GRCz11 8 4674875
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGTTGTGGACACACCGGGATACGGAGACGCCATCAACAGCCAGGACTGG[T/G]AAGTGTGTGTGTGTGTGTGTTTACTGAGATAATGATGTGTGTTGTGGTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6135
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019828 Nonsense 230 276 9 9
Genomic Location (Zv9):
Chromosome 8 (position 4822894)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 4565835
GRCz11 8 4622102
KASP Assay ID:
554-3827.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTGTGTGTGTTGTTTAAATGGGATAAAATTCAAGGATTTTGTGCCTAAT[A/T]GATGCATCTGGTCCAGTTTACAGTTTTATCAAATGCACATAATTGCGATT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link