vps37a

Ensembl ID:
ENSDARG00000017119
ZFIN ID:
ZDB-GENE-030131-8312
Description:
vacuolar protein sorting-associated protein 37A [Source:RefSeq peptide;Acc:NP_956284]
Human Orthologue:
VPS37A
Human Description:
vacuolar protein sorting 37 homolog A (S. cerevisiae) [Source:HGNC Symbol;Acc:24928]
Mouse Orthologue:
Vps37a
Mouse Description:
vacuolar protein sorting 37A (yeast) Gene [Source:MGI Symbol;Acc:MGI:1261835]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa16986 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa16986
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078675 Essential Splice Site 204 387 5 12
Genomic Location (Zv9):
Chromosome 1 (position 15212377)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 15777545
GRCz11 1 16470482
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACGGACTCATCACAGACCTTCCACTTCCTGTACCAACTGCTGACTCACAG[G/A]TACCGCTYAGTCCAAGATGAGCTAATTGGTTTATTCCAATTCCAGTKACT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Tonometry: Framingham Heart Study 100K Project: genome-wide associations for blood pressure and arterial stiffness. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link