asb12a

Ensembl ID:
ENSDARG00000017086
ZFIN ID:
ZDB-GENE-030131-1647
Description:
ankyrin repeat and SOCS box-containing protein 12a [Source:RefSeq peptide;Acc:NP_001119848]
Human Orthologue:
ASB12
Human Description:
ankyrin repeat and SOCS box-containing 12 [Source:HGNC Symbol;Acc:19763]
Mouse Orthologue:
Asb12
Mouse Description:
ankyrin repeat and SOCS box-containing 12 Gene [Source:MGI Symbol;Acc:MGI:1917642]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa26453 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa26453
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023306 Essential Splice Site 255 305 4 4
Genomic Location (Zv9):
Chromosome 5 (position 23805233)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 21518105
GRCz11 5 22021905
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAACACTATCATTTGTTAAATAACATTTTTAACACTGTTTTTTTTCCACA[G/A]GCTGCCCAAAGAGTCTTGCTTCTCAGTGTAGATTGACCATTCGCCGACAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link