zgc:92280

Ensembl ID:
ENSDARG00000017055
ZFIN ID:
ZDB-GENE-041114-133
Description:
zinc finger MYND domain-containing protein 12 [Source:RefSeq peptide;Acc:NP_001007305]
Human Orthologue:
ZMYND12
Human Description:
zinc finger, MYND-type containing 12 [Source:HGNC Symbol;Acc:21192]
Mouse Orthologue:
Zmynd12
Mouse Description:
zinc finger, MYND domain containing 12 Gene [Source:MGI Symbol;Acc:MGI:2140259]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa34421 Nonsense Available for shipment Available now
sa2433 Nonsense F2 line generated During 2018

Mutation Details

Allele Name:
sa34421
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008742 Nonsense 249 365 6 8
Genomic Location (Zv9):
Chromosome 8 (position 27762486)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 26890404
GRCz11 8 26909543
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTCTGCATGTGTGTGTACAGGTGGCAGGTTCATGGCACACCCACCTGTG[T/A]AAGCTGATGGATGGTATCAGTCAGAGTGCCACTCAACCAGACGAGTGTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2433
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008742 Nonsense 295 365 7 8
Genomic Location (Zv9):
Chromosome 8 (position 27759386)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 26887304
GRCz11 8 26906443
KASP Assay ID:
554-2925.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGAGTTGTATTCTAGAGTTTGAGGAACAGTGTGTGAAACCTCGGCCTGAA[C/T]AAYTAACCATGTTGGCTCACTCTCTGGCTATGCTGTGGCTGCTACGCGAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link