zgc:112138

Ensembl ID:
ENSDARG00000017047
ZFIN ID:
ZDB-GENE-050417-248
Description:
hypothetical protein LOC550432 [Source:RefSeq peptide;Acc:NP_001017737]
Human Orthologue:
SLC27A4
Human Description:
solute carrier family 27 (fatty acid transporter), member 4 [Source:HGNC Symbol;Acc:10998]
Mouse Orthologue:
Slc27a4
Mouse Description:
solute carrier family 27 (fatty acid transporter), member 4 Gene [Source:MGI Symbol;Acc:MGI:1347347]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa41599 Nonsense Mutation detected in F1 DNA During 2018
sa13961 Nonsense Available for shipment Available now
sa21677 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa41599
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004181 Nonsense 121 643 3 13
Genomic Location (Zv9):
Chromosome 10 (position 10724484)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 10800350
GRCz11 10 10758588
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCAAGGAGCTCGATGAGTACTCCAATCGCGTGGCCAACTTTTTACTCCAG[C/T]AAGGCTTCAGGGAGGGCGATGTGGTGGCTCTGTTCATGGAGAACCGCCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13961
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004181 Nonsense 248 643 5 13
Genomic Location (Zv9):
Chromosome 10 (position 10732731)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 10808597
GRCz11 10 10766835
KASP Assay ID:
2260-2958.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCCTCCTTTYCTTTTGCTTYTAGATCGGCTGTTTTACATCTACACATCC[G/T]GAACCACTGGAATGCCAAAAGCTGCTATTGTTGTACAYAGTCGGTAAGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21677
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004181 Nonsense 412 643 9 13
Genomic Location (Zv9):
Chromosome 10 (position 10739888)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 10815754
GRCz11 10 10773992
KASP Assay ID:
2260-2959.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTTAATTTCAGACAGGTGCTTGTGGATTTAATAGCCGAATCCTGCCCTA[T/A]GTCTACCCTATCCGCTTGGTCAAAGTGGATGAGGAGACCATGGAGCTCAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link