sqrdl

Ensembl ID:
ENSDARG00000017034
ZFIN ID:
ZDB-GENE-050417-436
Description:
sulfide:quinone oxidoreductase, mitochondrial [Source:RefSeq peptide;Acc:NP_001017881]
Human Orthologue:
SQRDL
Human Description:
sulfide quinone reductase-like (yeast) [Source:HGNC Symbol;Acc:20390]
Mouse Orthologue:
Sqrdl
Mouse Description:
sulfide quinone reductase-like (yeast) Gene [Source:MGI Symbol;Acc:MGI:1929899]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa6004 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa6004
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013668 Nonsense 95 445 3 10
ENSDART00000146451 Nonsense 133 483 3 10
Genomic Location (Zv9):
Chromosome 25 (position 33457410)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 32067812
GRCz11 25 32478769
KASP Assay ID:
554-3720.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTATATGGACATTAGTTGGCGCAGGGGCTAAAAGTGTTGCTTCCTCCGGA[C/T]GATCGACATCAAGTGTCATWCCATCAGGGGTGACGTGGGTSAAGTCTAAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Obesity-related traits: Novel genetic loci identified for the pathophysiology of childhood obesity in the Hispanic population. (View Study)
  • Weight: Genome-wide association study of anthropometric traits and evidence of interactions with age and study year in Filipino women. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link