zgc:165635

Ensembl ID:
ENSDARG00000017023
ZFIN ID:
ZDB-GENE-050309-170
Description:
putative adenylate kinase 7 [Source:RefSeq peptide;Acc:NP_001103168]
Human Orthologue:
AK7
Human Description:
adenylate kinase 7 [Source:HGNC Symbol;Acc:20091]
Mouse Orthologue:
Ak7
Mouse Description:
adenylate kinase 7 Gene [Source:MGI Symbol;Acc:MGI:1926051]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa23041 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa23041
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080029 Nonsense 540 699 15 18
Genomic Location (Zv9):
Chromosome 17 (position 18711131)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 18861142
GRCz11 17 18880978
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTCCTACATGCCTGAACAGTTCCTTCAGCGTTTAGCTAGATTTAGAGAT[A/T]GAAACGTAGAGGACGAGATGCCACTGAACTACTTTGAGGATCTGGAGATT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link