
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
myo10l2
- Ensembl ID:
- ENSDARG00000017004
- ZFIN ID:
- ZDB-GENE-070912-277
- Description:
- Novel protein similar to vertebrate myosin X (MYO10) [Source:UniProtKB/TrEMBL;Acc:B0S541]
- Human Orthologue:
- MYO10
- Human Description:
- myosin X [Source:HGNC Symbol;Acc:7593]
- Mouse Orthologue:
- Myo10
- Mouse Description:
- myosin X Gene [Source:MGI Symbol;Acc:MGI:107716]
Alleles
There are 6 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa39909 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
sa38351 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa11921 | Nonsense | Available for shipment | Available now |
sa19845 | Essential Splice Site | Available for shipment | Available now |
sa19844 | Nonsense | Available for shipment | Available now |
sa19843 | Essential Splice Site | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa39909
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000043201 | Essential Splice Site | 39 | 1753 | 2 | 32 |
ENSDART00000124493 | None | 243 | None | 6 | |
ENSDART00000139515 | None | 107 | None | 3 | |
ENSDART00000140159 | Essential Splice Site | 355 | 2069 | 11 | 41 |
The following transcripts of ENSDARG00000017004 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 2 (position 42748476)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 2 42797940 GRCz11 2 42647358 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ACTGATGTTAATTGCATGGTGTTCATACGAATGAGCTCTGTGTATGTGTA[G/A]CGCTCAGTAAAGCTGCAGATCTGCTGGGTTTGGATTGTGCTCAGCTGGCT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa38351
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000043201 | Nonsense | 105 | 1753 | 3 | 32 |
ENSDART00000124493 | None | 243 | None | 6 | |
ENSDART00000139515 | None | 107 | None | 3 | |
ENSDART00000140159 | Nonsense | 421 | 2069 | 12 | 41 |
The following transcripts of ENSDARG00000017004 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 2 (position 42746992)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 2 42796456 GRCz11 2 42645874 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TGGCTTTGTACTCTCAGTGCTTCACTTGGATCATTCGCAAACTGAACAAC[C/T]GAATCAACGGCAGTGAAGACTTCAGATCCATCGGCATCCTGGACATCTTT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa11921
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > G
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000043201 | Nonsense | 344 | 1753 | 11 | 32 |
ENSDART00000124493 | None | 243 | None | 6 | |
ENSDART00000139515 | None | 107 | None | 3 | |
ENSDART00000140159 | Nonsense | 660 | 2069 | 20 | 41 |
The following transcripts of ENSDARG00000017004 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 2 (position 42731710)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 2 42781174 GRCz11 2 42630592 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- CAGATGCCCGGTCAGTTTGAGCAGACTGTGGTCCTCAATCAGCTCAGATA[T/G]TCTGGGATGTTGGAAACRGTGAAAATCAGACGTTCTGGGTTTCCCATCAG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa19845
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- A > T
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000043201 | Essential Splice Site | 409 | 1753 | 13 | 32 |
ENSDART00000124493 | None | 243 | None | 6 | |
ENSDART00000139515 | None | 107 | None | 3 | |
ENSDART00000140159 | Essential Splice Site | 725 | 2069 | 22 | 41 |
The following transcripts of ENSDARG00000017004 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 2 (position 42730046)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 2 42779510 GRCz11 2 42628928 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CAGTAATCAGGCTTGAATGATGGGCTGCATTTGTTGTCTTTTCATTTTGC[A/T]GGTGTTTATGAGAGAGAGTTTGGAGCTGCGGTTAGAAAAACAAAGAGAAA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa19844
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000043201 | Nonsense | 490 | 1753 | 14 | 32 |
ENSDART00000124493 | None | 243 | None | 6 | |
ENSDART00000139515 | None | 107 | None | 3 | |
ENSDART00000140159 | Nonsense | 806 | 2069 | 23 | 41 |
The following transcripts of ENSDARG00000017004 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 2 (position 42729709)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 2 42779173 GRCz11 2 42628591 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TGCGATGGGCCACCGTCACCTTACAGAAGAGGCTCAGAGGTCAAAGGGCA[C/T]GAAGGCTCTATGTTCACCTTTTAGAGGAGAAGAGGAAGAGGGAAGAGGAA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa19843
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- T > C
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000043201 | Essential Splice Site | 1465 | 1753 | None | 32 |
ENSDART00000124493 | None | 243 | None | 6 | |
ENSDART00000139515 | None | 107 | None | 3 | |
ENSDART00000140159 | Essential Splice Site | 1781 | 2069 | None | 41 |
The following transcripts of ENSDARG00000017004 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 2 (position 42713378)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 2 42762842 GRCz11 2 42612260 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CCATAGAGAGCAGGACTGTGGTGGCCGACATCCTCGCCAAGTTTGAGAAG[T/C]GAGTCTCACCTTTTACACACCAGCTTCAGTCTGTCCAAAACCACAAATAT
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Major depressive disorder: Common genetic variation and antidepressant efficacy in major depressive disorder: a meta-analysis of three genome-wide pharmacogenetic studies. (View Study)
- Obesity-related traits: Novel genetic loci identified for the pathophysiology of childhood obesity in the Hispanic population. (View Study)
- Thiazide-induced adverse metabolic effects in hypertensive patients: Genome-wide association analyses suggest NELL1 influences adverse metabolic response to HCTZ in African Americans. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: