ssrp1b

Ensembl ID:
ENSDARG00000016994
ZFIN ID:
ZDB-GENE-041008-209
Description:
Structure specific recognition protein 1b [Source:UniProtKB/TrEMBL;Acc:B8A5B7]
Human Orthologue:
SSRP1
Human Description:
structure specific recognition protein 1 [Source:HGNC Symbol;Acc:11327]
Mouse Orthologue:
Ssrp1
Mouse Description:
structure specific recognition protein 1 Gene [Source:MGI Symbol;Acc:MGI:107912]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14765 Nonsense Available for shipment Available now
sa39668 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa14765
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003895 Nonsense 93 531 4 14
ENSDART00000100268 Nonsense 93 543 4 16
ENSDART00000131296 Nonsense 93 681 4 17
ENSDART00000142187 Nonsense 93 533 4 15
Genomic Location (Zv9):
Chromosome 1 (position 45167385)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 44010604
GRCz11 1 44711907
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTTTTGCGCAGGACCTTGAGAAGATCTCAGAATACTTCAAAGACAACTA[C/A]AAAGTGGAGCTRACAGAGAAAGACATGTGTGTTAAGGGCTGGAATTGGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39668
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003895 Essential Splice Site 409 531 10 14
ENSDART00000100268 Essential Splice Site 409 543 10 16
ENSDART00000131296 Essential Splice Site 409 681 10 17
ENSDART00000142187 Essential Splice Site 409 533 10 15
Genomic Location (Zv9):
Chromosome 1 (position 45179571)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 44022790
GRCz11 1 44724093
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGATCGAGACCAAGCAAGGCAATCAGTACACCTTCAGCAGCATCGAGAGG[T/C]ACCCAGAACCCCCGATGATACTCTTGTCTGGCTGTCGGGAACATCACTTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link