
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
bcar3
- Ensembl ID:
- ENSDARG00000016981
- ZFIN ID:
- ZDB-GENE-080513-4
- Description:
- breast cancer anti-estrogen resistance protein 3 [Source:RefSeq peptide;Acc:NP_001107092]
- Human Orthologue:
- BCAR3
- Human Description:
- breast cancer anti-estrogen resistance 3 [Source:HGNC Symbol;Acc:973]
- Mouse Orthologue:
- Bcar3
- Mouse Description:
- breast cancer anti-estrogen resistance 3 Gene [Source:MGI Symbol;Acc:MGI:1352501]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa44681 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa17906 | Essential Splice Site | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa44681
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000110550 | Nonsense | 65 | 912 | 2 | 13 |
ENSDART00000138253 | None | 208 | None | 3 | |
ENSDART00000138855 | None | 841 | None | 12 | |
ENSDART00000141763 | Nonsense | 28 | 137 | 2 | 3 |
ENSDART00000142358 | None | 746 | None | 10 |
- Genomic Location (Zv9):
- Chromosome 8 (position 15719472)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 8 15164816 GRCz11 8 15202521 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GTCTTCATCGAATCCATATTCTCTCTAGTATCCAAGTCCTGCGAGAACGT[G/T]AAACAAAACGAGGTTAGTCTTGCTTTTTCTGAATCTACTGTCAGACTACA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa17906
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000110550 | Essential Splice Site | 691 | 912 | 9 | 13 |
ENSDART00000138253 | None | 209 | None | 3 | |
ENSDART00000138855 | Essential Splice Site | 620 | 841 | 8 | 12 |
ENSDART00000141763 | None | 137 | None | 3 | |
ENSDART00000142358 | Essential Splice Site | 525 | 746 | 6 | 10 |
- Genomic Location (Zv9):
- Chromosome 8 (position 15608602)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 8 15053946 GRCz11 8 15091651 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- CTGGTGACCCTTCCTCATGGACGACAGCTGAGGCTGGACCTCATAGAGAG[G/A]TAAACAGATKYAGTCAACACGTCATGATRGCTCACTACAGACATCTTTCT
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: