zgc:165532

Ensembl ID:
ENSDARG00000016964
ZFIN ID:
ZDB-GENE-050417-213
Description:
Idh3g protein [Source:UniProtKB/TrEMBL;Acc:A7E278]
Human Orthologue:
CCDC90A
Human Description:
coiled-coil domain containing 90A [Source:HGNC Symbol;Acc:21097]
Mouse Orthologue:
Ccdc90a
Mouse Description:
coiled-coil domain containing 90A Gene [Source:MGI Symbol;Acc:MGI:1923387]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa34146 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa34146
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016660 Nonsense 47 258 2 9
Genomic Location (Zv9):
Chromosome 7 (position 44043727)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 41034027
GRCz11 7 41314100
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGTCCACCATTGTCTTTATTTCAGAGTTGAGCACTTCAGCTCAAGCTCTA[C/T]AGTATGATGTGAAAAGATCCGACATGGCCAAGTCTGGCAATAGGAAGTTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link