SLC16A1 (2 of 2)

Ensembl ID:
ENSDARG00000016963
Description:
solute carrier family 16, member 1 (monocarboxylic acid transporter 1) [Source:HGNC Symbol;Acc:10922
Human Orthologue:
SLC16A1
Human Description:
solute carrier family 16, member 1 (monocarboxylic acid transporter 1) [Source:HGNC Symbol;Acc:10922
Mouse Orthologue:
Slc16a1
Mouse Description:
solute carrier family 16 (monocarboxylic acid transporters), member 1 Gene [Source:MGI Symbol;Acc:MG

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa20813 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa20813
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023506 Nonsense 368 461 3 4
Genomic Location (Zv9):
Chromosome 6 (position 48986643)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 49047390
GRCz11 6 49046043
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCGAGACCCTCATGGATCTCGTTGGGGCTCAGCGGTTCTCCAGTGCTGTC[G/T]GACTGGTGACGATTGTGGAATGCGGGCCGGTGTTACTGGGGCCTCCTTTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link