Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
neurog3
- Ensembl ID:
- ENSDARG00000016951
- ZFIN ID:
- ZDB-GENE-010608-4
- Description:
- neurogenin 3 [Source:RefSeq peptide;Acc:NP_571890]
- Human Orthologues:
- NEUROG1, NEUROG2, NEUROG3
- Human Descriptions:
- neurogenin 1 [Source:HGNC Symbol;Acc:7764]
- neurogenin 2 [Source:HGNC Symbol;Acc:13805]
- neurogenin 3 [Source:HGNC Symbol;Acc:13806]
- Mouse Orthologues:
- Neurog1, Neurog2, Neurog3
- Mouse Descriptions:
- neurogenin 1 Gene [Source:MGI Symbol;Acc:MGI:107754]
- neurogenin 2 Gene [Source:MGI Symbol;Acc:MGI:109619]
- neurogenin 3 Gene [Source:MGI Symbol;Acc:MGI:893591]
Alleles
There is 1 allele of this gene:
| Allele name | Consequence | Status | Availability Estimate |
|---|---|---|---|
| sa211 | Nonsense | Confirmed mutation in F2 line | During 2018 |
Mutation Details
- Allele Name:
- sa211
- Current Status:
-
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- A > T
- Consequence:
- Nonsense
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000002863 | Nonsense | 74 | 208 | 2 | 2 |
- Genomic Location (Zv9):
- Chromosome 13 (position 25985534)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 13 25631194 GRCz11 13 25761644 - KASP Assay ID:
- 554-0155.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GAGAAGACAAAACAAGCAATAGAAAACTGAAGAAACTCATGTCAACAAGC[A/T]GACAGCGTGGAAATCGCAGAGTTAAGGCAAACGACAGAGAAAGGCACCGC
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:
