
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
ttyh2
- Ensembl ID:
- ENSDARG00000016934
- ZFIN ID:
- ZDB-GENE-040718-193
- Description:
- tweety homolog 2 [Source:RefSeq peptide;Acc:NP_001002490]
- Human Orthologue:
- TTYH2
- Human Description:
- tweety homolog 2 (Drosophila) [Source:HGNC Symbol;Acc:13877]
- Mouse Orthologue:
- Ttyh2
- Mouse Description:
- tweety homolog 2 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:2157091]
Alleles
There are 3 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa38903 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
sa16459 | Nonsense | Available for shipment | Available now |
sa35361 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa38903
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000009172 | Essential Splice Site | 102 | 535 | 2 | 14 |
ENSDART00000081046 | Essential Splice Site | 102 | 316 | 2 | 8 |
ENSDART00000134670 | Essential Splice Site | 102 | 483 | 2 | 12 |
- Genomic Location (Zv9):
- Chromosome 12 (position 40148327)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 12 38430633 GRCz11 12 38605054 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ACTCTTGCTGTGTGACTTGGGCTGCTGTTGCTGCCGGGCTCATCTGCTGG[T/A]ACGTACCACCCACCGTTCACATGCTGAGAGGATAAACCTGCTCAAGATGC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa16459
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000009172 | Nonsense | 238 | 535 | 5 | 14 |
ENSDART00000081046 | Nonsense | 238 | 316 | 5 | 8 |
ENSDART00000134670 | Nonsense | 238 | 483 | 5 | 12 |
- Genomic Location (Zv9):
- Chromosome 12 (position 40198575)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 12 38480881 GRCz11 12 38655302 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TGATCTTGGATCTGATCATCTGTCTTGCTGCTTGTCTGGGTCTGGCCAAA[C/T]AATCTCGMTGGTTGCTGACTACGTGAGTACAAACCTTSAGTACATCTMAT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa35361
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000009172 | Nonsense | 303 | 535 | 8 | 14 |
ENSDART00000081046 | Nonsense | 303 | 316 | 8 | 8 |
ENSDART00000134670 | Nonsense | 303 | 483 | 8 | 12 |
- Genomic Location (Zv9):
- Chromosome 12 (position 40215732)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 12 38498038 GRCz11 12 38672459 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ATTTTTGTTCTTGTTTTCTAGATATCGTCCATTATTACCTGTACTGCAGC[C/T]AGACTCTCCCAAACCCCTTTCAGCAGGTACTATGTTCAATATAAATGACT
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: