wdr5

Ensembl ID:
ENSDARG00000016903
ZFIN ID:
ZDB-GENE-040426-2082
Description:
WD repeat-containing protein 5 [Source:RefSeq peptide;Acc:NP_998264]
Human Orthologues:
WDR5, WDR5B
Human Descriptions:
WD repeat domain 5 [Source:HGNC Symbol;Acc:12757]
WD repeat domain 5B [Source:HGNC Symbol;Acc:17826]
Mouse Orthologues:
Wdr5, Wdr5b
Mouse Descriptions:
WD repeat domain 5 Gene [Source:MGI Symbol;Acc:MGI:2155884]
WD repeat domain 5B Gene [Source:MGI Symbol;Acc:MGI:1916794]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa14492 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa14492
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019750 Essential Splice Site 272 334 12 14
ENSDART00000144322   None 47 None 4
ENSDART00000147768   None 194 None 8
Genomic Location (Zv9):
Chromosome 21 (position 16875931)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 18250024
GRCz11 21 18286660
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAAACGAGAAGTACTGCATATTTGCTAATTTYTCTGTYACTGGTGGAAAG[G/A]TTTGTTGGCTTTACACTTTTCTAATCCATTGCCTCTCTTGACATGCTAAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Calcium levels: Common variants in the calcium-sensing receptor gene are associated with total serum calcium levels. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link