smarce1

Ensembl ID:
ENSDARG00000016871
ZFIN ID:
ZDB-GENE-030131-967
Description:
SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily e, member 1 [
Human Orthologue:
SMARCE1
Human Description:
SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily e, member 1 [S
Mouse Orthologue:
Smarce1
Mouse Description:
SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily e, member 1 Ge

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa33229 Nonsense Mutation detected in F1 DNA During 2018
sa12524 Nonsense Available for shipment Available now
sa12565 Nonsense Available for shipment Available now
sa20071 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa33229
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011319 Nonsense 83 424 5 10
ENSDART00000121981 Nonsense 79 420 6 11
Genomic Location (Zv9):
Chromosome 3 (position 35075376)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 34860572
GRCz11 3 34990080
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGTGTTCTCTGTCAGCTCTGAGCTGACTTTTGTATCTTTTGAAGGTTTG[G/A]GACCAAGTTAAAGCCTCTAATCCTGACCTGAAGCTATGGGAGATTGGCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12524
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011319 Nonsense 161 424 6 10
ENSDART00000121981 Nonsense 157 420 7 11
ENSDART00000011319 Nonsense 161 424 6 10
ENSDART00000121981 Nonsense 157 420 7 11
Genomic Location (Zv9):
Chromosome 3 (position 35076210)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 34861406
GRCz11 3 34990914
KASP Assay ID:
2259-3756.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACGTTAATGCAAAGAACCGCGCAGAAGCAGCTCYAGAGGAAGAAAGCCGG[C/T]AGAGACAGTCACGTTTAGACAAAGGGGAGCCCTACATGAGCATCCAACCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12565
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011319 Nonsense 161 424 6 10
ENSDART00000121981 Nonsense 157 420 7 11
ENSDART00000011319 Nonsense 161 424 6 10
ENSDART00000121981 Nonsense 157 420 7 11
Genomic Location (Zv9):
Chromosome 3 (position 35076210)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 34861406
GRCz11 3 34990914
KASP Assay ID:
2259-3756.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACGTTAATGCAAAGAACCGCGCAGAAGCAGCTCYAGAGGAAGAAAGCCGG[C/T]AGAGACAGTCACGTTTAGACAAAGGGGAGCCCTACATGAGCATCCAACCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20071
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011319 Nonsense 424 424 10 10
ENSDART00000121981 Nonsense 420 420 11 11
Genomic Location (Zv9):
Chromosome 3 (position 35079579)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 34864775
GRCz11 3 34994283
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCAGACCGCATCAGACAACACCCCTGAGGAGCGCCTGCCCACCCAGCCA[C/T]AATAACACATCCACACACTCTCACCTCGCTCTGCGTAGAGTCATGTGTCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link