zgc:77556

Ensembl ID:
ENSDARG00000016856
ZFIN ID:
ZDB-GENE-030131-7116
Description:
hypothetical protein LOC335176 [Source:RefSeq peptide;Acc:NP_997899]
Human Orthologues:
PON1, PON2, PON3
Human Descriptions:
paraoxonase 1 [Source:HGNC Symbol;Acc:9204]
paraoxonase 2 [Source:HGNC Symbol;Acc:9205]
paraoxonase 3 [Source:HGNC Symbol;Acc:9206]
Mouse Orthologues:
Pon1, Pon2, Pon3
Mouse Descriptions:
paraoxonase 1 Gene [Source:MGI Symbol;Acc:MGI:103295]
paraoxonase 2 Gene [Source:MGI Symbol;Acc:MGI:106687]
paraoxonase 3 Gene [Source:MGI Symbol;Acc:MGI:106686]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa36123 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa36123
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008326 Nonsense 280 355 8 9

The following transcripts of ENSDARG00000016856 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 26910046)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 24755721
GRCz11 16 24670753
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGGTCTCTCTGTGACAACATTGAGGTGGATCGTGAGACTGGAGATCTGTG[G/A]ATTGGCTGTCACCCAAACGGTCTCAAATGTGTTTTTCATGATCCAAATGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link