si:rp71-23d18.1

Ensembl ID:
ENSDARG00000016825
ZFIN IDs:
ZDB-GENE-001201-5, ZDB-GENE-001201-5, ZDB-GENE-001201-5, ZDB-GENE-091118-131
Description:
vitellogenin 6 [Source:RefSeq peptide;Acc:NP_001116082]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa43855 Essential Splice Site Mutation detected in F1 DNA During 2018
sa24181 Nonsense Available for shipment Available now
sa43854 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa43855
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078231   None 251 None 11
ENSDART00000078238   None 355 None 8
ENSDART00000143443 Essential Splice Site 160 1368 4 28

The following transcripts of ENSDARG00000016825 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 22 (position 25289734)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 24789640
GRCz11 22 24817264
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCTTCAGCTCAACCTCAAGAAGACGCAGAACATCTACGAGCTGCAAGAG[G/A]TGAGGAAATCCCCTTAGGACAATTCTGCGGTATTTTGAGTTCTGCAATCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24181
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078231   None 251 None 11
ENSDART00000078238   None 355 None 8
ENSDART00000143443 Nonsense 288 1368 7 28

The following transcripts of ENSDARG00000016825 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 22 (position 25289103)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 24789009
GRCz11 22 24816633
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGATTGAGAAGACCCCTGTTGTTCCAATCAAAGCTGATTACATGCCCCGT[G/T]GATCCCTGCAGTACGAGTTTGCATCTGAGATTCTTCAGACCCCCATTCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43854
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078231   None 251 None 11
ENSDART00000078238   None 355 None 8
ENSDART00000143443 Nonsense 1009 1368 21 28

The following transcripts of ENSDARG00000016825 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 22 (position 25285667)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 24785573
GRCz11 22 24813197
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCACAATGCTGCTTTTATCAGAAATTCTACGCTGTTCTACATAATTGGA[C/T]AGCACTCAGCCCATGTTGCAGTGGCAAGAGGTGAGAGATGATAGAGAGAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link