zgc:152891

Ensembl ID:
ENSDARG00000016789
ZFIN ID:
ZDB-GENE-061013-229
Description:
12-lipoxygenase [Source:RefSeq peptide;Acc:NP_001070178]
Human Orthologues:
ALOX12B, ALOX15B, ALOXE3
Human Descriptions:
arachidonate 12-lipoxygenase, 12R type [Source:HGNC Symbol;Acc:430]
arachidonate 15-lipoxygenase, type B [Source:HGNC Symbol;Acc:434]
arachidonate lipoxygenase 3 [Source:HGNC Symbol;Acc:13743]
Mouse Orthologues:
Alox12b, Alox8, Aloxe3
Mouse Descriptions:
arachidonate 12-lipoxygenase, 12R type Gene [Source:MGI Symbol;Acc:MGI:1274782]
arachidonate 8-lipoxygenase Gene [Source:MGI Symbol;Acc:MGI:1098228]
arachidonate lipoxygenase 3 Gene [Source:MGI Symbol;Acc:MGI:1345140]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16077 Nonsense Available for shipment Available now
sa37349 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa16077
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011572 Nonsense 319 663 8 15
ENSDART00000123166 Nonsense 319 663 7 14
Genomic Location (Zv9):
Chromosome 21 (position 29967472)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 31167723
GRCz11 21 31204418
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTGTCTGCTGCATTACAACCAAGATGRAGAACTAAAAYCTATTGCTATA[C/T]AAGTAAGCACAGTWTCAATCAGAACAAAAATTTCATTWGACWGAATTTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37349
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011572 Nonsense 459 663 11 15
ENSDART00000123166 Nonsense 459 663 10 14
Genomic Location (Zv9):
Chromosome 21 (position 29965741)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 31165992
GRCz11 21 31202687
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGCCAGATGATGTGAAAGAGCGAGGCCTGGATGCTCTGCCGGTCTGTTA[T/G]TATGCTCAAGATGCTCTCAGAGTCTGGGATGCTTTACACAGGTACTTGAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link