ENSDARG00000016782 - Zebrafish Mutation Project

Search Zebrafish Mutation Project

e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457

You can look for mutant lines by browsing a complete list or by searching for a particular gene

huwe1

Ensembl ID:: ENSDARG00000016782
ZFIN ID:: ZDB-GENE-081104-387
Human Orthologue:: HUWE1
Human Description:: HECT, UBA and WWE domain containing 1 [Source:HGNC Symbol;Acc:30892]
Mouse Orthologue:: Huwe1
Mouse Description:: HECT, UBA and WWE domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:1926884]

Alleles

There are 13 alleles of this gene:

Allele name	Consequence	Status	Availability Estimate
sa37738	Splice Site, Nonsense	Mutation detected in F1 DNA	During 2018
sa618	Essential Splice Site	Available for shipment	Available now
sa37739	Nonsense	Available for shipment	Available now
sa15608	Essential Splice Site	Available for shipment	Available now
sa24357	Nonsense	Available for shipment	Available now
sa44001	Splice Site, Nonsense	Mutation detected in F1 DNA	During 2018
sa17915	Essential Splice Site	Available for shipment	Available now
sa37740	Nonsense	Mutation detected in F1 DNA	During 2018
sa39413	Nonsense	Mutation detected in F1 DNA	During 2018
sa37741	Essential Splice Site	Mutation detected in F1 DNA	During 2018
sa44002	Essential Splice Site	Mutation detected in F1 DNA	During 2018
sa24358	Essential Splice Site	Available for shipment	Available now
sa30743	Essential Splice Site	Mutation detected in F1 DNA	During 2018

Mutation Details

Allele Name:: sa37738
Current Status:: Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:: We currently estimate that this allele will be available during 2018.
Mutation:: C > A
Consequence:: Splice Site, Nonsense

Transcript ID	Consequence	Amino Acid Affected	Amino Acid Total	Exon Affected	Exon Total
ENSDART00000006657	Splice Site, Nonsense	49	4569	3	80
ENSDART00000146990	Splice Site, Nonsense	53	4474	3	79

Genomic Location (Zv9):

Chromosome 23 (position 28737404)

Other Location(s):

Assembly	Chromosome	Position
GRCz10	23	28567971
GRCz11	23	28494512

KASP Assay ID:

None (used for ordering genotyping assays from LGC Genomics)

KASP Sequence:

None

Flanking Sequence:

TCAATATGCATGTTCAGATCTTCATTGATGACCTGTTTCTCTTCCCAGTG[C/A]GAGTTGTATCATTGGGTGGACTTGCTGGACCGCTTTGATGGCATCCTCTG

Associated Phenotype:

Not determined

Mutation Details

Allele Name:: sa618
Current Status:: Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:: Order Allele From ZIRC
Mutation:: T > C
Consequence:: Essential Splice Site

Transcript ID	Consequence	Amino Acid Affected	Amino Acid Total	Exon Affected	Exon Total
ENSDART00000006657	Essential Splice Site	231	4569	7	80
ENSDART00000146990	Essential Splice Site	235	4474	7	79

Genomic Location (Zv9):

Chromosome 23 (position 28740634)

Other Location(s):

Assembly	Chromosome	Position
GRCz10	23	28571201
GRCz11	23	28497742

KASP Assay ID:

554-0528.1 (used for ordering genotyping assays from LGC Genomics)

KASP Sequence:

GTCAAGCAGTAATACGCTACACTACATTCATATCGAACAACTTGATAAGG[T/C]GAGTTTCTGGGGTTTACATTTGCTGTCCTTGTGGAACAGTTAATGGAAGT

Associated Phenotype:

Normal

Stage	Entity	Quality	Tag
Larval:Day 5 ZFS:0000037	whole organism ZFA:0001094	quality PATO:0000001	normal PATO:0000461

Mutation Details

Allele Name:: sa37739
Current Status:: Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:: Order Allele From ZIRC
Mutation:: C > T
Consequence:: Nonsense

Transcript ID	Consequence	Amino Acid Affected	Amino Acid Total	Exon Affected	Exon Total
ENSDART00000006657	Nonsense	423	4569	12	80
ENSDART00000146990	Nonsense	426	4474	12	79

Genomic Location (Zv9):

Chromosome 23 (position 28743691)

Other Location(s):

Assembly	Chromosome	Position
GRCz10	23	28574258
GRCz11	23	28500799

KASP Assay ID:

None (used for ordering genotyping assays from LGC Genomics)

KASP Sequence:

None

Flanking Sequence:

GTTAACCTATGCCACTTTCACATCAGGTGATCAAGTTCCTAGGGGACGAG[C/T]AGGACCAGATTACCTTTGTGACGCGGGCAGTGAGAGTTGTGGATCTCATC

Associated Phenotype:

Not determined

Mutation Details

Allele Name:: sa15608
Current Status:: Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:: Order Allele From ZIRC
Order Allele From EZRC
Mutation:: T > C
Consequence:: Essential Splice Site

Transcript ID	Consequence	Amino Acid Affected	Amino Acid Total	Exon Affected	Exon Total
ENSDART00000006657	Essential Splice Site	533	4569	14	80
ENSDART00000146990	Essential Splice Site	536	4474	14	79

Genomic Location (Zv9):

Chromosome 23 (position 28746954)

Other Location(s):

Assembly	Chromosome	Position
GRCz10	23	28577521
GRCz11	23	28504062

KASP Assay ID:

None (used for ordering genotyping assays from LGC Genomics)

KASP Sequence:

GAGACCGATTCGCGAGCACARAGCAATGCATCCAGCACCCCAAGAGCAGG[T/C]AAAAAYACTNCCAARTACTCTAACTCACAWGTCAGTGGGTGTGYAGTTTAG

Associated Phenotype:

Not determined

Mutation Details

Allele Name:: sa24357
Current Status:: Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:: Order Allele From ZIRC
Mutation:: C > T
Consequence:: Nonsense

Transcript ID	Consequence	Amino Acid Affected	Amino Acid Total	Exon Affected	Exon Total
ENSDART00000006657	Nonsense	957	4569	24	80
ENSDART00000146990	Nonsense	960	4474	24	79

Genomic Location (Zv9):

Chromosome 23 (position 28753635)

Other Location(s):

Assembly	Chromosome	Position
GRCz10	23	28584202
GRCz11	23	28510743

KASP Assay ID:

2261-7913.1 (used for ordering genotyping assays from LGC Genomics)

KASP Sequence:

None

Flanking Sequence:

GCATCTCTTGCTCCTCCTTTCAGAGCGAGATTCGTGCTATCTCTGTGAAT[C/T]AATGGGGATCTCAACTGGGTCTTAGTGTTTTGAACAAACTGAGTCAGCTG

Associated Phenotype:

Not determined

Mutation Details

Allele Name:: sa44001
Current Status:: Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:: We currently estimate that this allele will be available during 2018.
Mutation:: C > T
Consequence:: Splice Site, Nonsense

Transcript ID	Consequence	Amino Acid Affected	Amino Acid Total	Exon Affected	Exon Total
ENSDART00000006657	Splice Site, Nonsense	1396	4569	30	80
ENSDART00000146990		None	4474	None	79

Genomic Location (Zv9):

Chromosome 23 (position 28757769)

Other Location(s):

Assembly	Chromosome	Position
GRCz10	23	28588336
GRCz11	23	28514877

KASP Assay ID:

None (used for ordering genotyping assays from LGC Genomics)

KASP Sequence:

None

Flanking Sequence:

ACTCTACTACAGCACGCAGAGAGCCACAGGTCAACCAAGCTCAGCTCACA[C/T]AGGTATGTCACTTCCTGTTATTAGATATTCCTGCTGCATTTAAATTTGAC

Associated Phenotype:

Not determined

Mutation Details

Allele Name:: sa17915
Current Status:: Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:: Order Allele From ZIRC
Order Allele From EZRC
Mutation:: T > G
Consequence:: Essential Splice Site

Transcript ID	Consequence	Amino Acid Affected	Amino Acid Total	Exon Affected	Exon Total
ENSDART00000006657	Essential Splice Site	1437	4569	31	80
ENSDART00000146990	Essential Splice Site	1404	4474	31	79

Genomic Location (Zv9):

Chromosome 23 (position 28758134)

Other Location(s):

Assembly	Chromosome	Position
GRCz10	23	28588701
GRCz11	23	28515242

KASP Assay ID:

None (used for ordering genotyping assays from LGC Genomics)

KASP Sequence:

TGAGTACCTGCTCACACACCCTCCACCACTGCTCAGCGCGGCTGTCAGAG[T/G]AAGACCCTAAYCAACACAGACAAAACCCTCWGTCTTTCTCCCATACACTC

Associated Phenotype:

Not determined

Mutation Details

Allele Name:: sa37740
Current Status:: Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:: We currently estimate that this allele will be available during 2018.
Mutation:: T > A
Consequence:: Nonsense

Transcript ID	Consequence	Amino Acid Affected	Amino Acid Total	Exon Affected	Exon Total
ENSDART00000006657	Nonsense	2745	4569	55	80
ENSDART00000146990		None	4474	None	79

Genomic Location (Zv9):

Chromosome 23 (position 28776635)

Other Location(s):

Assembly	Chromosome	Position
GRCz10	23	28607202
GRCz11	23	28533743

KASP Assay ID:

None (used for ordering genotyping assays from LGC Genomics)

KASP Sequence:

None

Flanking Sequence:

AGATGGACAGATGAGTGTAAAGTGCTGGATGCTGAGAGCATGCATGACTG[T/A]GTGGCAGGTGAGATCATCTCAGAACGAATATATGATAGCATCTGTTGTTT

Associated Phenotype:

Not determined

Mutation Details

Allele Name:: sa39413
Current Status:: Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:: We currently estimate that this allele will be available during 2018.
Mutation:: C > T
Consequence:: Nonsense

Transcript ID	Consequence	Amino Acid Affected	Amino Acid Total	Exon Affected	Exon Total
ENSDART00000006657	Nonsense	3412	4569	63	80
ENSDART00000146990	Nonsense	3336	4474	62	79

Genomic Location (Zv9):

Chromosome 23 (position 28784672)

Other Location(s):

Assembly	Chromosome	Position
GRCz10	23	28615239
GRCz11	23	28541780

KASP Assay ID:

None (used for ordering genotyping assays from LGC Genomics)

KASP Sequence:

None

Flanking Sequence:

TATCAATGGACGCAGCTCTTGGATGCAGAACCAACATCTTTCAGATCCAG[C/T]GAGTATCAGGCAGGAAACACGCAGAGAGGCATTCAGCAGGAGGGAGTGTG

Associated Phenotype:

Not determined

Mutation Details

Allele Name:: sa37741
Current Status:: Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:: We currently estimate that this allele will be available during 2018.
Mutation:: T > C
Consequence:: Essential Splice Site

Transcript ID	Consequence	Amino Acid Affected	Amino Acid Total	Exon Affected	Exon Total
ENSDART00000006657	Essential Splice Site	4023	4569	70	80
ENSDART00000146990	Essential Splice Site	3947	4474	69	79

Genomic Location (Zv9):

Chromosome 23 (position 28797768)

Other Location(s):

Assembly	Chromosome	Position
GRCz10	23	28628335
GRCz11	23	28554876

KASP Assay ID:

None (used for ordering genotyping assays from LGC Genomics)

KASP Sequence:

None

Flanking Sequence:

ATGGATGTGGATCAGCCCTCTCCTTTGGAACAGGACCAGCCAACATTAGG[T/C]GAGTGTCTGGGAATATAGGACAACCTAACAATAGGAACGTCACTGGCTTG

Associated Phenotype:

Not determined

Mutation Details

Allele Name:: sa44002
Current Status:: Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:: We currently estimate that this allele will be available during 2018.
Mutation:: G > A
Consequence:: Essential Splice Site

Transcript ID	Consequence	Amino Acid Affected	Amino Acid Total	Exon Affected	Exon Total
ENSDART00000006657	Essential Splice Site	4472	4569	78	80
ENSDART00000146990	Essential Splice Site	4396	4474	77	79

Genomic Location (Zv9):

Chromosome 23 (position 28807192)

Other Location(s):

Assembly	Chromosome	Position
GRCz10	23	28637759
GRCz11	23	28564300

KASP Assay ID:

None (used for ordering genotyping assays from LGC Genomics)

KASP Sequence:

None

Flanking Sequence:

ACCTCAAGGCCAATACTGAATACCATAAATATCAGTCCAGTTCTATTCAG[G/A]TGTGTACACACACAATAGGATGACATGAAATAAAATATTTGATTGTTTAT

Associated Phenotype:

Not determined

Mutation Details

Allele Name:: sa24358
Current Status:: Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:: Order Allele From ZIRC
Order Allele From EZRC
Mutation:: T > C
Consequence:: Essential Splice Site

Transcript ID	Consequence	Amino Acid Affected	Amino Acid Total	Exon Affected	Exon Total
ENSDART00000006657	Essential Splice Site	4472	4569	78	80
ENSDART00000146990	Essential Splice Site	4396	4474	77	79

Genomic Location (Zv9):

Chromosome 23 (position 28807193)

Other Location(s):

Assembly	Chromosome	Position
GRCz10	23	28637760
GRCz11	23	28564301

KASP Assay ID:

None (used for ordering genotyping assays from LGC Genomics)

KASP Sequence:

None

Flanking Sequence:

CCTCAAGGCCAATACTGAATACCATAAATATCAGTCCAGTTCTATTCAGG[T/C]GTGTACACACACAATAGGATGACATGAAATAAAATATTTGATTGTTTATT

Associated Phenotype:

Not determined

Mutation Details

Allele Name:: sa30743
Current Status:: Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:: We currently estimate that this allele will be available during 2018.
Mutation:: G > T
Consequence:: Essential Splice Site

Transcript ID	Consequence	Amino Acid Affected	Amino Acid Total	Exon Affected	Exon Total
ENSDART00000006657	Essential Splice Site	4536	4569	79	80
ENSDART00000146990	Essential Splice Site	4460	4474	None	79

Genomic Location (Zv9):

Chromosome 23 (position 28808902)

Other Location(s):

Assembly	Chromosome	Position
GRCz10	23	28639469
GRCz11	23	28566010

KASP Assay ID:

None (used for ordering genotyping assays from LGC Genomics)

KASP Sequence:

None

Flanking Sequence:

ATCCACCGAGATGACCGCTCCACTGACCGCCTGCCCTCTGCGCACACTTG[G/T]TAAATGCTCATATATTAATGATGTGCCTTTTAAAACAAACAATTCAAGTG

Associated Phenotype:

Not determined

OMIM

Mental retardation, X-linked syndromic, Turner type

More OMIM information for HUWE1

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: