huwe1
- Ensembl ID:
- ENSDARG00000016782
- ZFIN ID:
- ZDB-GENE-081104-387
- Human Orthologue:
- HUWE1
- Human Description:
- HECT, UBA and WWE domain containing 1 [Source:HGNC Symbol;Acc:30892]
- Mouse Orthologue:
- Huwe1
- Mouse Description:
- HECT, UBA and WWE domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:1926884]
Alleles
There are 13 alleles of this gene:
Allele name |
Consequence |
Status |
Availability Estimate |
sa37738 |
Splice Site, Nonsense |
Mutation detected in F1 DNA |
During 2018 |
sa618 |
Essential Splice Site |
Available for shipment |
Available now |
sa37739 |
Nonsense |
Available for shipment |
Available now |
sa15608 |
Essential Splice Site |
Available for shipment |
Available now |
sa24357 |
Nonsense |
Available for shipment |
Available now |
sa44001 |
Splice Site, Nonsense |
Mutation detected in F1 DNA |
During 2018 |
sa17915 |
Essential Splice Site |
Available for shipment |
Available now |
sa37740 |
Nonsense |
Mutation detected in F1 DNA |
During 2018 |
sa39413 |
Nonsense |
Mutation detected in F1 DNA |
During 2018 |
sa37741 |
Essential Splice Site |
Mutation detected in F1 DNA |
During 2018 |
sa44002 |
Essential Splice Site |
Mutation detected in F1 DNA |
During 2018 |
sa24358 |
Essential Splice Site |
Available for shipment |
Available now |
sa30743 |
Essential Splice Site |
Mutation detected in F1 DNA |
During 2018 |
Mutation Details
- Allele Name:
- sa37738
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- C > A
- Consequence:
- Splice Site, Nonsense
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000006657 |
Splice Site, Nonsense |
49 |
4569 |
3 |
80 |
ENSDART00000146990 |
Splice Site, Nonsense |
53 |
4474 |
3 |
79 |
- Genomic Location (Zv9):
- Chromosome 23 (position 28737404)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
23 |
28567971 |
GRCz11 |
23 |
28494512 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TCAATATGCATGTTCAGATCTTCATTGATGACCTGTTTCTCTTCCCAGTG[C/A]GAGTTGTATCATTGGGTGGACTTGCTGGACCGCTTTGATGGCATCCTCTG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa618
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
- Mutation:
- T > C
- Consequence:
- Essential Splice Site
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000006657 |
Essential Splice Site |
231 |
4569 |
7 |
80 |
ENSDART00000146990 |
Essential Splice Site |
235 |
4474 |
7 |
79 |
- Genomic Location (Zv9):
- Chromosome 23 (position 28740634)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
23 |
28571201 |
GRCz11 |
23 |
28497742 |
- KASP Assay ID:
- 554-0528.1 (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- GTCAAGCAGTAATACGCTACACTACATTCATATCGAACAACTTGATAAGG[T/C]GAGTTTCTGGGGTTTACATTTGCTGTCCTTGTGGAACAGTTAATGGAAGT
- Associated Phenotype:
Normal
Mutation Details
- Allele Name:
- sa37739
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
- Mutation:
- C > T
- Consequence:
- Nonsense
- Genomic Location (Zv9):
- Chromosome 23 (position 28743691)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
23 |
28574258 |
GRCz11 |
23 |
28500799 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GTTAACCTATGCCACTTTCACATCAGGTGATCAAGTTCCTAGGGGACGAG[C/T]AGGACCAGATTACCTTTGTGACGCGGGCAGTGAGAGTTGTGGATCTCATC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa15608
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
Order Allele From EZRC
- Mutation:
- T > C
- Consequence:
- Essential Splice Site
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000006657 |
Essential Splice Site |
533 |
4569 |
14 |
80 |
ENSDART00000146990 |
Essential Splice Site |
536 |
4474 |
14 |
79 |
- Genomic Location (Zv9):
- Chromosome 23 (position 28746954)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
23 |
28577521 |
GRCz11 |
23 |
28504062 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- GAGACCGATTCGCGAGCACARAGCAATGCATCCAGCACCCCAAGAGCAGG[T/C]AAAAAYACTNCCAARTACTCTAACTCACAWGTCAGTGGGTGTGYAGTTTAG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa24357
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
- Mutation:
- C > T
- Consequence:
- Nonsense
- Genomic Location (Zv9):
- Chromosome 23 (position 28753635)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
23 |
28584202 |
GRCz11 |
23 |
28510743 |
- KASP Assay ID:
- 2261-7913.1 (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GCATCTCTTGCTCCTCCTTTCAGAGCGAGATTCGTGCTATCTCTGTGAAT[C/T]AATGGGGATCTCAACTGGGTCTTAGTGTTTTGAACAAACTGAGTCAGCTG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa44001
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- C > T
- Consequence:
- Splice Site, Nonsense
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000006657 |
Splice Site, Nonsense |
1396 |
4569 |
30 |
80 |
ENSDART00000146990 |
|
None |
4474 |
None |
79 |
- Genomic Location (Zv9):
- Chromosome 23 (position 28757769)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
23 |
28588336 |
GRCz11 |
23 |
28514877 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ACTCTACTACAGCACGCAGAGAGCCACAGGTCAACCAAGCTCAGCTCACA[C/T]AGGTATGTCACTTCCTGTTATTAGATATTCCTGCTGCATTTAAATTTGAC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa17915
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
Order Allele From EZRC
- Mutation:
- T > G
- Consequence:
- Essential Splice Site
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000006657 |
Essential Splice Site |
1437 |
4569 |
31 |
80 |
ENSDART00000146990 |
Essential Splice Site |
1404 |
4474 |
31 |
79 |
- Genomic Location (Zv9):
- Chromosome 23 (position 28758134)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
23 |
28588701 |
GRCz11 |
23 |
28515242 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- TGAGTACCTGCTCACACACCCTCCACCACTGCTCAGCGCGGCTGTCAGAG[T/G]AAGACCCTAAYCAACACAGACAAAACCCTCWGTCTTTCTCCCATACACTC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa37740
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- T > A
- Consequence:
- Nonsense
- Genomic Location (Zv9):
- Chromosome 23 (position 28776635)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
23 |
28607202 |
GRCz11 |
23 |
28533743 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AGATGGACAGATGAGTGTAAAGTGCTGGATGCTGAGAGCATGCATGACTG[T/A]GTGGCAGGTGAGATCATCTCAGAACGAATATATGATAGCATCTGTTGTTT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa39413
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
- Genomic Location (Zv9):
- Chromosome 23 (position 28784672)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
23 |
28615239 |
GRCz11 |
23 |
28541780 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TATCAATGGACGCAGCTCTTGGATGCAGAACCAACATCTTTCAGATCCAG[C/T]GAGTATCAGGCAGGAAACACGCAGAGAGGCATTCAGCAGGAGGGAGTGTG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa37741
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- T > C
- Consequence:
- Essential Splice Site
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000006657 |
Essential Splice Site |
4023 |
4569 |
70 |
80 |
ENSDART00000146990 |
Essential Splice Site |
3947 |
4474 |
69 |
79 |
- Genomic Location (Zv9):
- Chromosome 23 (position 28797768)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
23 |
28628335 |
GRCz11 |
23 |
28554876 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ATGGATGTGGATCAGCCCTCTCCTTTGGAACAGGACCAGCCAACATTAGG[T/C]GAGTGTCTGGGAATATAGGACAACCTAACAATAGGAACGTCACTGGCTTG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa44002
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000006657 |
Essential Splice Site |
4472 |
4569 |
78 |
80 |
ENSDART00000146990 |
Essential Splice Site |
4396 |
4474 |
77 |
79 |
- Genomic Location (Zv9):
- Chromosome 23 (position 28807192)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
23 |
28637759 |
GRCz11 |
23 |
28564300 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ACCTCAAGGCCAATACTGAATACCATAAATATCAGTCCAGTTCTATTCAG[G/A]TGTGTACACACACAATAGGATGACATGAAATAAAATATTTGATTGTTTAT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa24358
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
Order Allele From EZRC
- Mutation:
- T > C
- Consequence:
- Essential Splice Site
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000006657 |
Essential Splice Site |
4472 |
4569 |
78 |
80 |
ENSDART00000146990 |
Essential Splice Site |
4396 |
4474 |
77 |
79 |
- Genomic Location (Zv9):
- Chromosome 23 (position 28807193)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
23 |
28637760 |
GRCz11 |
23 |
28564301 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CCTCAAGGCCAATACTGAATACCATAAATATCAGTCCAGTTCTATTCAGG[T/C]GTGTACACACACAATAGGATGACATGAAATAAAATATTTGATTGTTTATT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa30743
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- G > T
- Consequence:
- Essential Splice Site
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000006657 |
Essential Splice Site |
4536 |
4569 |
79 |
80 |
ENSDART00000146990 |
Essential Splice Site |
4460 |
4474 |
None |
79 |
- Genomic Location (Zv9):
- Chromosome 23 (position 28808902)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
23 |
28639469 |
GRCz11 |
23 |
28566010 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ATCCACCGAGATGACCGCTCCACTGACCGCCTGCCCTCTGCGCACACTTG[G/T]TAAATGCTCATATATTAATGATGTGCCTTTTAAAACAAACAATTCAAGTG
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes
(for example, a new allele is generated or an allele is made available
for distribution) then please enter your details below: