zgc:63611

Ensembl ID:
ENSDARG00000016775
ZFIN IDs:
ZDB-GENE-040426-1189, ZDB-GENE-040426-1189
Description:
Zgc:63611 protein [Source:UniProtKB/TrEMBL;Acc:Q7SY15]
Human Orthologue:
AQR
Human Description:
aquarius homolog (mouse) [Source:HGNC Symbol;Acc:29513]
Mouse Orthologue:
Aqr
Mouse Description:
aquarius Gene [Source:MGI Symbol;Acc:MGI:1276102]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa2924 Essential Splice Site F2 line generated During 2018
sa16798 Nonsense Available for shipment Available now
sa7441 Missense Mutation detected in F1 DNA During 2018
sa23194 Nonsense Available for shipment Available now
sa45623 Nonsense Mutation detected in F1 DNA During 2018
sa17038 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa2924
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013418 Essential Splice Site 58 285 3 14
ENSDART00000123746 Essential Splice Site 58 1524 3 37
ENSDART00000130412 Essential Splice Site 58 1524 3 37
Genomic Location (Zv9):
Chromosome 17 (position 51643555)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 51029669
GRCz11 17 51118567
KASP Assay ID:
554-3291.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTTTCAGAWCATTGAAGAGGTTTACCAGAATGAGATCCTCAAATCAAAG[T/C]AAGACCAATCATGCTGGCTTCYTGTAAAAGTTCGYAGCTAGTGTATTTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16798
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013418 Nonsense 245 285 10 14
ENSDART00000123746   270 1524 11 37
ENSDART00000130412   270 1524 11 37
Genomic Location (Zv9):
Chromosome 17 (position 51629378)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 51015062
GRCz11 17 51103960
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTAACCATGTCCATCTTTGCAAAGGCTCTGCTCCCGACCCGCCGTTGGTT[C/T]AACACTGTGCTGGACGATGCTCATCTGATGGTCAAATGCCAGCTGTCTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7441
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013418   None 285 None 14
ENSDART00000123746 Missense 624 1524 19 37
ENSDART00000130412 Missense 624 1524 19 37
Genomic Location (Zv9):
Chromosome 17 (position 51607530)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 50992419
GRCz11 17 51081317
KASP Assay ID:
554-4235.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTYCGTGAAGGTCCTGATCCAAAGCCCAAAYTGAGAGGTGACACCAGGA[C/T]GTACCGAGTGTGGCTGGACTCGAACCAATACCAGCAGGACATGACCAACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23194
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013418   None 285 None 14
ENSDART00000123746 Nonsense 743 1524 20 37
ENSDART00000130412 Nonsense 743 1524 20 37
Genomic Location (Zv9):
Chromosome 17 (position 51606280)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 50991169
GRCz11 17 51080067
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTGTTTCCCAGAGCACACGGTCAAGGTGACGGAGGAGGATCCCGCTAGA[C/T]AGATGCCACCATTCAGGTTCATTCATGCTCCGTTTTCAACACAACATACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45623
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013418   None 285 None 14
ENSDART00000123746 Nonsense 859 1524 24 37
ENSDART00000130412 Nonsense 858 1524 24 37
Genomic Location (Zv9):
Chromosome 17 (position 51600240)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 50985129
GRCz11 17 51074027
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGCATTGCTTCCTACATATCTGTTGTGTGTGTGTGTGTTGTTCAGGCTT[T/A]AAATCAGCTGTTTGAGAAGATTATGGCGCTAGACATCGATGAACGCCACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17038
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013418   None 285 None 14
ENSDART00000123746 Essential Splice Site 1081 1524 28 37
ENSDART00000130412 Essential Splice Site 1078 1524 28 37
Genomic Location (Zv9):
Chromosome 17 (position 51578398)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 50963287
GRCz11 17 51052185
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCMGCTCARATCCTGGAGATTGAGACCTTCATYCCTCTGCTGCTGCAGG[T/C]ACTGCTCTCGCTCGCTCCCAAATACACCCYGAGTTTTCTTGTAYTATTTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link