
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
tfa
- Ensembl ID:
- ENSDARG00000016771
- ZFIN ID:
- ZDB-GENE-980526-35
- Description:
- transferrin-a [Source:RefSeq peptide;Acc:NP_001015057]
- Human Orthologues:
- LTF, TF
- Human Descriptions:
- lactotransferrin [Source:HGNC Symbol;Acc:6720]
- transferrin [Source:HGNC Symbol;Acc:11740]
- Mouse Orthologues:
- 1300017J02Rik, Ltf, RP24-421P3.2, Trf
- Mouse Descriptions:
- lactotransferrin Gene [Source:MGI Symbol;Acc:MGI:96837]
- RIKEN cDNA 1300017J02 gene Gene [Source:MGI Symbol;Acc:MGI:1919025]
- signal recognition particle receptor subunit beta [Source:RefSeq peptide;Acc:NP_033301]
- transferrin Gene [Source:MGI Symbol;Acc:MGI:98821]
Alleles
There are 6 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa32879 | Essential Splice Site | Available for shipment | Available now |
sa19720 | Essential Splice Site | Available for shipment | Available now |
sa12059 | Nonsense | Available for shipment | Available now |
sa32878 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
sa44526 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
sa15651 | Essential Splice Site | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa32879
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000003845 | None | 675 | None | 17 | |
ENSDART00000108611 | None | 673 | None | 17 | |
ENSDART00000124119 | None | 286 | None | 6 | |
ENSDART00000125647 | None | 674 | None | 18 | |
ENSDART00000127207 | Essential Splice Site | 152 | 169 | 9 | 9 |
- Genomic Location (Zv9):
- Chromosome 2 (position 16590088)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 2 17114895 GRCz11 2 16783485 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CAACTATATAATACATTTTGGATATGCTAAAATGTTTATTATGCTTTTTT[G/A]TGTTCTCCAGCTGTGTCAGAATTCTTCTCGAGCAGTTGTGTCCCTGGTGT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa19720
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- T > C
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000003845 | Essential Splice Site | 204 | 675 | 5 | 17 |
ENSDART00000108611 | Essential Splice Site | 204 | 673 | 5 | 17 |
ENSDART00000124119 | Essential Splice Site | 214 | 286 | 4 | 6 |
ENSDART00000125647 | Essential Splice Site | 205 | 674 | 6 | 18 |
ENSDART00000127207 | None | 169 | None | 9 |
- Genomic Location (Zv9):
- Chromosome 2 (position 16589940)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 2 17115043 GRCz11 2 16783633 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GCAGCTGCTCACACAACGAGAAGTACTTCGGTGATGACGGAGCCTTCCAG[T/C]ATGAGCCACACTAATACAATCCCTTATATAAGTATACACCAAGTTCAATT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa12059
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000003845 | Nonsense | 267 | 675 | 7 | 17 |
ENSDART00000108611 | Nonsense | 267 | 673 | 7 | 17 |
ENSDART00000124119 | Nonsense | 277 | 286 | 6 | 6 |
ENSDART00000125647 | Nonsense | 268 | 674 | 8 | 18 |
ENSDART00000127207 | None | 169 | None | 9 |
- Genomic Location (Zv9):
- Chromosome 2 (position 16587983)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 2 17117000 GRCz11 2 16785590 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- AGAGAGCCTGCCCGCACTGTCATTGCTCGCACCGATACTGATTTACAATA[T/A]GTTTATGATGTCCTGAAGCAGATTCCGGTATGCCCTTACAGTGTCACATA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa32878
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- A > G
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000003845 | Essential Splice Site | 408 | 675 | 11 | 17 |
ENSDART00000108611 | Essential Splice Site | 408 | 673 | 11 | 17 |
ENSDART00000124119 | None | 286 | None | 6 | |
ENSDART00000125647 | Essential Splice Site | 409 | 674 | 12 | 18 |
ENSDART00000127207 | None | 169 | None | 9 | |
ENSDART00000003845 | Essential Splice Site | 408 | 675 | 11 | 17 |
ENSDART00000108611 | Essential Splice Site | 408 | 673 | 11 | 17 |
ENSDART00000124119 | None | 286 | None | 6 | |
ENSDART00000125647 | Essential Splice Site | 409 | 674 | 12 | 18 |
ENSDART00000127207 | None | 169 | None | 9 |
- Genomic Location (Zv9):
- Chromosome 2 (position 16585907)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 2 17119076 GRCz11 2 16787666 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AGAATTGACATTTTTGATGAAACCTAACATTTTATTCACTACTCTTTTGC[A/C]GAAAGCTGCTCTAGTGGTTCAGGAGGTAAATATTACTATAATTATTTGGT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa44526
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- A > C
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000003845 | Essential Splice Site | 408 | 675 | 11 | 17 |
ENSDART00000108611 | Essential Splice Site | 408 | 673 | 11 | 17 |
ENSDART00000124119 | None | 286 | None | 6 | |
ENSDART00000125647 | Essential Splice Site | 409 | 674 | 12 | 18 |
ENSDART00000127207 | None | 169 | None | 9 | |
ENSDART00000003845 | Essential Splice Site | 408 | 675 | 11 | 17 |
ENSDART00000108611 | Essential Splice Site | 408 | 673 | 11 | 17 |
ENSDART00000124119 | None | 286 | None | 6 | |
ENSDART00000125647 | Essential Splice Site | 409 | 674 | 12 | 18 |
ENSDART00000127207 | None | 169 | None | 9 |
- Genomic Location (Zv9):
- Chromosome 2 (position 16585907)
- Other Location(s):
-
Assembly Chromosome Position GRCz11 2 16787666 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AGAATTGACATTTTTGATGAAACCTAACATTTTATTCACTACTCTTTTGC[A/C]GAAAGCTGCTCTAGTGGTTCAGGAGGTAAATATTACTATAATTATTTGGT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa15651
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- A > T
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000003845 | Essential Splice Site | 608 | 675 | 16 | 17 |
ENSDART00000108611 | Essential Splice Site | 606 | 673 | 16 | 17 |
ENSDART00000124119 | None | 286 | None | 6 | |
ENSDART00000125647 | Essential Splice Site | 607 | 674 | 17 | 18 |
ENSDART00000127207 | None | 169 | None | 9 |
- Genomic Location (Zv9):
- Chromosome 2 (position 16581925)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 2 17123058 GRCz11 2 16791648 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TATATGTCTTACAAATAAAGTTTTAAATCCCATCTCTTATCATATGTTTC[A/T]GAGCAAAAATAATGACCTTTTCACCTCCAAAGATGGGAAAAATCTCCTTT
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- AIDS progression: Genome-wide association study implicates PARD3B-based AIDS restriction. (View Study)
- Alcohol consumption: Genome-wide association study identifies two loci strongly affecting transferrin glycosylation. (View Study)
- Hepcidin levels: Association of HFE and TMPRSS6 genetic variants with iron and erythrocyte parameters is only in part dependent on serum hepcidin concentrations. (View Study)
- Iron levels: Identification of a common variant in the TFR2 gene implicated in the physiological regulation of serum iron levels. (View Study)
- Iron status biomarkers: Genome-wide association study identifies genetic loci associated with iron deficiency. (View Study)
- Iron status biomarkers: Variants in TF and HFE explain approximately 40% of genetic variation in serum-transferrin levels. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: