zgc:171671

Ensembl ID:
ENSDARG00000016763
ZFIN ID:
ZDB-GENE-071004-18
Description:
hypothetical protein LOC100002269 [Source:RefSeq peptide;Acc:NP_001098611]
Human Orthologue:
ZNF292
Human Description:
zinc finger protein 292 [Source:HGNC Symbol;Acc:18410]
Mouse Orthologue:
Zfp292
Mouse Description:
zinc finger protein 292 Gene [Source:MGI Symbol;Acc:MGI:1353423]

Alleles

There are 13 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9274 Nonsense Mutation detected in F1 DNA During 2018
sa8386 Nonsense Mutation detected in F1 DNA During 2018
sa9571 Nonsense Available for shipment Available now
sa8910 Nonsense Mutation detected in F1 DNA During 2018
sa18214 Nonsense Available for shipment Available now
sa10055 Nonsense Available for shipment Available now
sa28931 Nonsense Mutation detected in F1 DNA During 2018
sa23187 Nonsense Available for shipment Available now
sa43006 Nonsense Mutation detected in F1 DNA During 2018
sa23186 Nonsense Available for shipment Available now
sa23185 Nonsense Available for shipment Available now
sa10631 Nonsense Available for shipment Available now
sa10167 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa9274
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004424 Nonsense 45 2313 1 8
ENSDART00000111678 Nonsense 45 200 1 9
Genomic Location (Zv9):
Chromosome 17 (position 49594493)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 49355577
GRCz11 17 49438552
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTCCGAGTCGACGCTAGATGCCTCCAATAGTTTTTGTCAGGATTTCTGC[C/T]AAGTACGGTTTTATTCATGCGCTTWAGTCTGTCAGTCTTTGTTCGCGGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8386
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004424 Nonsense 299 2313 7 8
ENSDART00000111678   None 200 8 9
Genomic Location (Zv9):
Chromosome 17 (position 49577694)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 49338778
GRCz11 17 49421753
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGGAGCTGACACTGTTTTGGAGTAAGCTTCTAATAAGGCTGGAATCAAAA[C/T]AKGCCTTTTTGGAGCAATGCAGACTGTTAGCAYGCCTCTYTGAGAGCGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9571
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004424 Nonsense 424 2313 8 8
ENSDART00000111678   None 200 None 9
Genomic Location (Zv9):
Chromosome 17 (position 49577230)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 49338314
GRCz11 17 49421289
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGAGGATCCACCAATTCTAAATTCACTACGCTGTGACTTGTTGCTGGCCT[T/G]AAAGATAAAGTGGCCTTTTGATCCGGAGTTTTGGGACTGGAAAAYTCTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8910
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004424 Nonsense 501 2313 8 8
ENSDART00000111678   None 200 None 9
ENSDART00000004424 Nonsense 501 2313 8 8
ENSDART00000111678   None 200 None 9
ENSDART00000004424 Nonsense 501 2313 8 8
ENSDART00000111678   None 200 None 9
Genomic Location (Zv9):
Chromosome 17 (position 49577000)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 49338084
GRCz11 17 49421059
KASP Assay ID:
2261-1579.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTCTTACGAACTCTTTGAAGTTGGARCAGAAAGAAAGAAGAAGAAGAAY[G/T]AAWTTAAGAAGGTRAAGGAGAAGGGATTWGTTTCTGCTCGATTCCGCAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18214
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004424 Nonsense 501 2313 8 8
ENSDART00000111678   None 200 None 9
ENSDART00000004424 Nonsense 501 2313 8 8
ENSDART00000111678   None 200 None 9
ENSDART00000004424 Nonsense 501 2313 8 8
ENSDART00000111678   None 200 None 9
Genomic Location (Zv9):
Chromosome 17 (position 49577000)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 49338084
GRCz11 17 49421059
KASP Assay ID:
2261-1579.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTCTTACGAACTCTTTGAAGTTGGARCAGAAAGAAAGAAGAAGAAGAAY[G/T]AAWTTAAGAAGGTRAAGGAGAAGGGATTWGTTTCTGCTCGATTCCGCAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10055
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004424 Nonsense 501 2313 8 8
ENSDART00000111678   None 200 None 9
ENSDART00000004424 Nonsense 501 2313 8 8
ENSDART00000111678   None 200 None 9
ENSDART00000004424 Nonsense 501 2313 8 8
ENSDART00000111678   None 200 None 9
Genomic Location (Zv9):
Chromosome 17 (position 49577000)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 49338084
GRCz11 17 49421059
KASP Assay ID:
2261-1579.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTCTTACGAACTCTTTGAAGTTGGARCAGAAAGAAAGAAGAAGAAGAAY[G/T]AAWTTAAGAAGGTRAAGGAGAAGGGATTWGTTTCTGCTCGATTCCGCAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa28931
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004424 Nonsense 703 2313 8 8
ENSDART00000111678   None 200 None 9
Genomic Location (Zv9):
Chromosome 17 (position 49576394)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 49337478
GRCz11 17 49420453
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGCTCATGTTAAGGCCCATAAAAACGAGCAGGAAGCAACAGACTTCCTT[C/T]AACTACAGAGCCGGAAGGCAATGTGCCAATATTGTCACCGCCAGTTTGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23187
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004424 Nonsense 1342 2313 8 8
ENSDART00000111678   None 200 None 9
Genomic Location (Zv9):
Chromosome 17 (position 49574475)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 49335559
GRCz11 17 49418534
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGTGAAAATAGGAAATGCAAAAAAATTAAATCATCAAAAAGAACCAAATG[G/A]CCTGCCATAATACAGGATGGGAAGGTCATTTGCTGCAGGTGCTACAGAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43006
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004424 Nonsense 1833 2313 8 8
ENSDART00000111678   None 200 None 9
Genomic Location (Zv9):
Chromosome 17 (position 49573004)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 49334088
GRCz11 17 49417063
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGCCATATCGATGCATTCATGAGGGATGTGTGGCTGCCTTTTCAATCCAA[C/T]AAAATCTCATCCTCCATTATAGGGCTATGCATCAGTCAGAATGTGATGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23186
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004424 Nonsense 1967 2313 8 8
ENSDART00000111678   None 200 None 9
Genomic Location (Zv9):
Chromosome 17 (position 49572601)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 49333685
GRCz11 17 49416660
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACATTCGGATGTCAATTCAAAGGTTGCGACCGGGTATATACGACAAAGT[C/A]GAACCTTCTTCGACATCTCATGAAGAAGCATGATGCTACTTTCGAAACCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23185
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004424 Nonsense 2083 2313 8 8
ENSDART00000111678   None 200 None 9
Genomic Location (Zv9):
Chromosome 17 (position 49572252)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 49333336
GRCz11 17 49416311
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGAACTGTGATTCAGTAATGAATGATGAACGGAATATATTGCATCATTA[C/A]ACCACTCATGGCCTCACGGAACAATACATTGAGGATCAGAGAAGCCAGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10631
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004424 Nonsense 2230 2313 8 8
ENSDART00000111678   None 200 None 9
Genomic Location (Zv9):
Chromosome 17 (position 49571813)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 49332897
GRCz11 17 49415872
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACCACAGAAAGAATAAAGTCGCACTAAAACTTTACAAGTCCTCGAAGTTT[C/T]AGACTACCGTCCTGAAGTTCAGCCAAAATCCTCTGTCCAATCCATCGAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10167
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004424 Nonsense 2284 2313 8 8
ENSDART00000111678   None 200 None 9
Genomic Location (Zv9):
Chromosome 17 (position 49571649)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 49332733
GRCz11 17 49415708
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGAAATCCTCTAAAGATCGAGAGAGTGAACAATGTTAAAATTGTCATGTA[T/G]AAAAACCAGTCCCCTGGTYCTAGACTTCTGCTGAAGCAACTTCAAGATAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link