tbca

Ensembl ID:
ENSDARG00000016754
ZFIN ID:
ZDB-GENE-040426-962
Description:
tubulin-specific chaperone A [Source:RefSeq peptide;Acc:NP_957348]
Human Orthologue:
TBCA
Human Description:
tubulin folding cofactor A [Source:HGNC Symbol;Acc:11579]
Mouse Orthologue:
Tbca
Mouse Description:
tubulin cofactor A Gene [Source:MGI Symbol;Acc:MGI:107549]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa29516 Nonsense Mutation detected in F1 DNA During 2018
sa37230 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa29516
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023997 Nonsense 7 108 1 4
Genomic Location (Zv9):
Chromosome 21 (position 7485054)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 7807521
GRCz11 21 7545189
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGCCTTTTAACGATTTCAAACTGCACGGACAATGGCTGATCCAAGAATA[C/T]GACAAATAAAAATCAAGACGGGTGTGGTGAAACGGTAAGCAGACAGAACG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37230
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023997 Nonsense 8 108 1 4
Genomic Location (Zv9):
Chromosome 21 (position 7485057)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 7807524
GRCz11 21 7545192
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTTTTAACGATTTCAAACTGCACGGACAATGGCTGATCCAAGAATACGA[C/T]AAATAAAAATCAAGACGGGTGTGGTGAAACGGTAAGCAGACAGAACGGTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link