
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
tbca
- Ensembl ID:
- ENSDARG00000016754
- ZFIN ID:
- ZDB-GENE-040426-962
- Description:
- tubulin-specific chaperone A [Source:RefSeq peptide;Acc:NP_957348]
- Human Orthologue:
- TBCA
- Human Description:
- tubulin folding cofactor A [Source:HGNC Symbol;Acc:11579]
- Mouse Orthologue:
- Tbca
- Mouse Description:
- tubulin cofactor A Gene [Source:MGI Symbol;Acc:MGI:107549]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa29516 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa37230 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa29516
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000023997 | Nonsense | 7 | 108 | 1 | 4 |
- Genomic Location (Zv9):
- Chromosome 21 (position 7485054)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 21 7807521 GRCz11 21 7545189 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TTGCCTTTTAACGATTTCAAACTGCACGGACAATGGCTGATCCAAGAATA[C/T]GACAAATAAAAATCAAGACGGGTGTGGTGAAACGGTAAGCAGACAGAACG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa37230
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000023997 | Nonsense | 8 | 108 | 1 | 4 |
- Genomic Location (Zv9):
- Chromosome 21 (position 7485057)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 21 7807524 GRCz11 21 7545192 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CCTTTTAACGATTTCAAACTGCACGGACAATGGCTGATCCAAGAATACGA[C/T]AAATAAAAATCAAGACGGGTGTGGTGAAACGGTAAGCAGACAGAACGGTC
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: