slco1c1

Ensembl ID:
ENSDARG00000016749
ZFIN ID:
ZDB-GENE-041210-50
Description:
solute carrier organic anion transporter family member 1C1 [Source:RefSeq peptide;Acc:NP_001038462]
Human Orthologue:
SLCO1C1
Human Description:
solute carrier organic anion transporter family, member 1C1 [Source:HGNC Symbol;Acc:13819]
Mouse Orthologue:
Slco1c1
Mouse Description:
solute carrier organic anion transporter family, member 1c1 Gene [Source:MGI Symbol;Acc:MGI:1889679]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa33362 Essential Splice Site Mutation detected in F1 DNA During 2018
sa9443 Nonsense Available for shipment Available now
sa8495 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa33362
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039083 Essential Splice Site 139 710 4 15
ENSDART00000134442 Essential Splice Site 139 689 4 15
ENSDART00000141760   None 90 None 3

The following transcripts of ENSDARG00000016749 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 4 (position 2573100)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 2771979
GRCz11 4 2702090
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTCACTCGGGACGTTTCTCATCGCTTTGCCCCATTTCATAATCGGCCGG[T/G]AAGTCAGAGTGTGTGTTTCTGTCACAGCGAGGGTCACATGGATCCAGTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9443
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039083 Nonsense 297 710 8 15
ENSDART00000134442 Nonsense 297 689 8 15
ENSDART00000141760   None 90 None 3

The following transcripts of ENSDARG00000016749 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 4 (position 2566284)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 2765163
GRCz11 4 2695274
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTCATTACCCTGCTTTCAGCCGTGCCCTTCTGGTTCCTGCCCAAGTCTT[T/A]GCCACTGCCAGAGAGAMGACTGAGCAAATACTCTCCGGAGCGYAACAGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8495
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039083 Essential Splice Site 459 710 11 15
ENSDART00000134442 Essential Splice Site 459 689 11 15
ENSDART00000141760   None 90 None 3

The following transcripts of ENSDARG00000016749 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 4 (position 2560858)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 2759737
GRCz11 4 2689848
KASP Assay ID:
2259-4355.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCATTAGAGGAWAAATKAATAATTGCTTCKCTAATGCTTGTGTGTCCATC[A/C]GGACRGAGAGTCTGTTTATGGCRGACGGCTCTCTGCGAGCGTCCTGCAAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link