zgc:92765

Ensembl ID:
ENSDARG00000016745
ZFIN ID:
ZDB-GENE-040718-297
Description:
hypothetical protein LOC436832 [Source:RefSeq peptide;Acc:NP_001002559]
Human Orthologue:
C2orf18
Human Description:
chromosome 2 open reading frame 18 [Source:HGNC Symbol;Acc:26055]
Mouse Orthologue:
4930471M23Rik
Mouse Description:
RIKEN cDNA 4930471M23 gene Gene [Source:MGI Symbol;Acc:MGI:1922169]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12824 Essential Splice Site Available for shipment Available now
sa39279 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa12824
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016864 Essential Splice Site 217 374 5 6
ENSDART00000016864 Essential Splice Site 217 374 5 6
Genomic Location (Zv9):
Chromosome 20 (position 25937056)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 26008359
GRCz11 20 25907449
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTGTTTACAAGCATAATGTGCATCCACTCAAGGCTGTTGGGACTGAAGG[T/A]AAAGTTTTAGAATTATTCATTTTCACATAAAGCCACTGACTAATTTGATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39279
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016864 Essential Splice Site 217 374 5 6
ENSDART00000016864 Essential Splice Site 217 374 5 6
Genomic Location (Zv9):
Chromosome 20 (position 25937056)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 26008359
GRCz11 20 25907449
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTGTTTACAAGCATAATGTGCATCCACTCAAGGCTGTTGGGACTGAAGG[T/C]AAAGTTTTAGAATTATTCATTTTCACATAAAGCCACTGACTAATTTGATC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link