rgs7bpb

Ensembl ID:
ENSDARG00000016742
ZFIN ID:
ZDB-GENE-030131-9502
Description:
Regulator of G-protein signaling 7-binding protein B [Source:UniProtKB/Swiss-Prot;Acc:Q4V9P3]
Human Orthologue:
RGS7BP
Human Description:
regulator of G-protein signaling 7 binding protein [Source:HGNC Symbol;Acc:23271]
Mouse Orthologue:
Rgs7bp
Mouse Description:
regulator of G-protein signalling 7 binding protein Gene [Source:MGI Symbol;Acc:MGI:106334]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa44966 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa44966
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039043 Nonsense 76 251 2 6

The following transcripts of ENSDARG00000016742 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 19766208)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 20901697
GRCz11 21 20938333
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTCTTCATCGTGAGCAGGTCATCTCCATAGGAGAGAATACAACCGACTG[T/A]CCTTCTTTAAGGGCACAGATGCACAAGACTCGCGTCAAAGGATGCGCCGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link