zgc:85869

Ensembl ID:
ENSDARG00000016725
ZFIN ID:
ZDB-GENE-040426-2321
Description:
growth arrest and DNA damage 45 gamma like [Source:RefSeq peptide;Acc:NP_998391]
Human Orthologue:
GADD45G
Human Description:
growth arrest and DNA-damage-inducible, gamma [Source:HGNC Symbol;Acc:4097]
Mouse Orthologue:
Gadd45g
Mouse Description:
growth arrest and DNA-damage-inducible 45 gamma Gene [Source:MGI Symbol;Acc:MGI:1346325]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa7481 Missense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa7481
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015224 Missense 57 155 2 3
ENSDART00000125471 Missense 112 210 2 3
Genomic Location (Zv9):
Chromosome 21 (position 19543246)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 20678735
GRCz11 21 20715371
KASP Assay ID:
554-4279.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTACATTTGTGATTTTCTTATATTTCAGTGACCCAGACAGCGTGTCATTC[T/A]GCGTCCTGGCGGTGGATGAGGAGTTTGAGTGCGACATCGCYCTGCAGATC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link