gnao1a

Ensembl ID:
ENSDARG00000016676
ZFIN ID:
ZDB-GENE-040426-1757
Description:
guanine nucleotide-binding protein G(o) subunit alpha [Source:RefSeq peptide;Acc:NP_957081]
Human Orthologue:
GNAO1
Human Description:
guanine nucleotide binding protein (G protein), alpha activating activity polypeptide O [Source:HGNC
Mouse Orthologue:
Gnao1
Mouse Description:
guanine nucleotide binding protein, alpha O Gene [Source:MGI Symbol;Acc:MGI:95775]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa45638 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa45638
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130125 Essential Splice Site None 354 9 9
Genomic Location (Zv9):
Chromosome 18 (position 22756979)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 22987202
GRCz11 18 22976268
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGAACCACTTTTTGGAGGTGTGGCTCCGCCCCCGGTGCTGGAGAGGGCGG[A/G]GCTACGCACTGCTGTACAGATTCATGCGCTTTCTCTTGGTTTTTTGAGAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link