zgc:85763

Ensembl ID:
ENSDARG00000016607
ZFIN ID:
ZDB-GENE-030219-147
Description:
enoyl-CoA hydratase domain-containing protein 2, mitochondrial [Source:RefSeq peptide;Acc:NP_997953
Human Orthologue:
ECHDC2
Human Description:
enoyl CoA hydratase domain containing 2 [Source:HGNC Symbol;Acc:23408]
Mouse Orthologue:
Echdc2
Mouse Description:
enoyl Coenzyme A hydratase domain containing 2 Gene [Source:MGI Symbol;Acc:MGI:1289238]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa9061 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa9061
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014721 Essential Splice Site 179 319 5 9
Genomic Location (Zv9):
Chromosome 20 (position 16253529)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 16313482
GRCz11 20 16213065
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTCGGCGGCGGTTTGGAGTTGGCACTGGCATGTGACCTTCGCACGGCAG[G/A]TGAGAGGSTGATGTGACCTTCACCWSGGGCATCGAGCCWGCTGAKGATGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link