zgc:92661

Ensembl ID:
ENSDARG00000016594
ZFIN ID:
ZDB-GENE-040718-122
Description:
HAUS augmin-like complex subunit 4 [Source:RefSeq peptide;Acc:NP_001002425]
Human Orthologue:
HAUS4
Human Description:
HAUS augmin-like complex, subunit 4 [Source:HGNC Symbol;Acc:20163]
Mouse Orthologue:
Haus4
Mouse Description:
HAUS augmin-like complex, subunit 4 Gene [Source:MGI Symbol;Acc:MGI:1261794]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa40347 Splice Site, Nonsense Mutation detected in F1 DNA During 2018
sa14302 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa40347
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022132 Splice Site, Nonsense 159 367 5 10
Genomic Location (Zv9):
Chromosome 5 (position 1818173)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 1444523
GRCz11 5 1498963
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCATTCTGGGATTGACTGCAGAGCGAGTGAAGAGACTGATGCCTTCTGAA[C/T]AGGTGCTACATTACTCACTCAGTGTTTGAGGACAAGTGCATTGAAATAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14302
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022132 Essential Splice Site 240 367 7 10
Genomic Location (Zv9):
Chromosome 5 (position 1821923)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 1448273
GRCz11 5 1502713
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CMGAGAGAAYRCCACGCTACTGCMGCGGCAGACACACACGTACCTGTCTG[T/G]GAGTCCAGAGACACTCAKTAGCCGCATTTCCRYTATCGGGCCAGTGCRAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link