
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
rgs7
- Ensembl ID:
- ENSDARG00000016584
- ZFIN ID:
- ZDB-GENE-040718-276
- Description:
- regulator of G-protein signaling 7 [Source:RefSeq peptide;Acc:NP_001002541]
- Human Orthologue:
- RGS7
- Human Description:
- regulator of G-protein signaling 7 [Source:HGNC Symbol;Acc:10003]
- Mouse Orthologue:
- Rgs7
- Mouse Description:
- regulator of G protein signaling 7 Gene [Source:MGI Symbol;Acc:MGI:1346089]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa32144 | Nonsense | Available for shipment | Available now |
sa18359 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa32144
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000044993 | Nonsense | 286 | 459 | 13 | 18 |
ENSDART00000104895 | Nonsense | 286 | 459 | 13 | 18 |
ENSDART00000131863 | Nonsense | 286 | 459 | 13 | 18 |
- Genomic Location (Zv9):
- Chromosome 17 (position 19550177)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 17 19700188 GRCz11 17 19720024 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CTCTCTTTAATCCGTTTGTTTTTATGATTGTGTTGTAGTTTGCTGAGCTA[T/A]GCAGAGCAGTATTCAGACTATGACCCTTTCTTGTCCACTCCTGATCCCTC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa18359
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000044993 | Nonsense | 338 | 459 | 14 | 18 |
ENSDART00000104895 | Nonsense | 338 | 459 | 14 | 18 |
ENSDART00000131863 | Nonsense | 338 | 459 | 14 | 18 |
- Genomic Location (Zv9):
- Chromosome 17 (position 19550782)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 17 19700793 GRCz11 17 19720629 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- RCCTGGTCAGACTCGWGTTAGACGCTGGGGTTTTGGGATTGATGAGGTGT[T/A]GAAAGATCCGGTYGGGAGRGAGCAGTTTCTCAAGTTCCTAGAGTCTGAAT
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Obesity-related traits: Novel genetic loci identified for the pathophysiology of childhood obesity in the Hispanic population. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: