zgc:154046

Ensembl ID:
ENSDARG00000016545
ZFIN ID:
ZDB-GENE-061103-289
Description:
hypothetical protein LOC562075 [Source:RefSeq peptide;Acc:NP_001073466]
Human Orthologue:
CRAT
Human Description:
carnitine O-acetyltransferase [Source:HGNC Symbol;Acc:2342]
Mouse Orthologue:
Crat
Mouse Description:
carnitine acetyltransferase Gene [Source:MGI Symbol;Acc:MGI:109501]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa18928 Nonsense Available for shipment Available now
sa16665 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa18928
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098567 Nonsense 35 630 2 14
ENSDART00000139250   None 110 None 7

The following transcripts of ENSDARG00000016545 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 46611962)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 44933907
GRCz11 8 44927813
KASP Assay ID:
2260-1032.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCGTCTACTGAGTCCCATACCAGTTGTCCAAATTTCTGACCGGTCGCTGT[T/A]ACATCAAGAAAGTCTGCCAAAGCTACCCGTTCCTCCACTGAAGCAAACAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16665
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098567 Nonsense 275 630 7 14
ENSDART00000139250 Nonsense 2 110 1 7

The following transcripts of ENSDARG00000016545 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 46580486)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 44965383
GRCz11 8 44959289
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAANAATAATNGTTTGCATGCTTGTGCCACAAATKKTTCTCTTTTTYAGAC[A/T]AGACAAATAAGGAGTCGGTRCGGGCAATCCAGAAGAGTATCTTCACAGTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link