zgc:162298

Ensembl ID:
ENSDARG00000016531
ZFIN ID:
ZDB-GENE-070410-63
Description:
hypothetical protein LOC559349 [Source:RefSeq peptide;Acc:NP_001103927]
Human Orthologue:
KLHL4
Human Description:
kelch-like 4 (Drosophila) [Source:HGNC Symbol;Acc:6355]
Mouse Orthologue:
Klhl4
Mouse Description:
kelch-like 4 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:2442829]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24959 Nonsense Mutation detected in F1 DNA During 2018
sa7392 Missense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa24959
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044389 Nonsense 92 327 1 4
ENSDART00000126344 Nonsense 92 567 1 9
ENSDART00000137695   None 23 None 2

The following transcripts of ENSDARG00000016531 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 14 (position 27815020)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 26507817
GRCz11 14 26805922
KASP Assay ID:
554-7586.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGGACCCACATCTGTTTATGCCAGGCCGGGCAATCAATCATGGCATCAG[C/T]AAAACATCATCCAGCAGCTCCAAGCTAGCGAGGAGCTTCCCAAGAGCAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7392
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044389 Missense 254 327 4 4
ENSDART00000126344 Missense 253 567 5 9
ENSDART00000137695   None 23 None 2

The following transcripts of ENSDARG00000016531 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 14 (position 27839639)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 26532436
GRCz11 14 26830541
KASP Assay ID:
554-4123.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCAGGAGTCCTGGAGCTAAAAGAGGAGACGATTGAAAGTCTTTTAGCTG[C/A]CGCTTGTCTCCTCCAGCTCTCACAAGTTATTCAGGTCTGCTGCAACTTTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link