ENSDARG00000016527

Ensembl ID:
ENSDARG00000016527
Human Orthologue:
RP4-697K14.7
Human Description:
Peroxisomal proliferator-activated receptor A-interacting complex 285 kDa protein [Source:UniProtKB/
Mouse Orthologue:
BC006779
Mouse Description:
cDNA sequence BC006779 Gene [Source:MGI Symbol;Acc:MGI:2385169]

Alleles

There are 9 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa8413 Nonsense Mutation detected in F1 DNA During 2018
sa8867 Nonsense Mutation detected in F1 DNA During 2018
sa18418 Nonsense Available for shipment Available now
sa15330 Nonsense Available for shipment Available now
sa20836 Nonsense Available for shipment Available now
sa40812 Nonsense Mutation detected in F1 DNA During 2018
sa8462 Essential Splice Site Mutation detected in F1 DNA During 2018
sa7054 Essential Splice Site Mutation detected in F1 DNA During 2018
sa20837 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa8413
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018498 Nonsense 1308 2507 9 21
ENSDART00000018498 Nonsense 1308 2507 9 21
Genomic Location (Zv9):
Chromosome 6 (position 58497490)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 58600618
GRCz11 6 58594849
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAATCTCATTGATTATAGAAGTGGATGCRCAGACTAATCGCATAAAGAGA[A/T]GATTTWTCTGCAAGTCTGTGATTCACTCYAACAGGAAATTTTCCTAYGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8867
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018498 Nonsense 1308 2507 9 21
ENSDART00000018498 Nonsense 1308 2507 9 21
Genomic Location (Zv9):
Chromosome 6 (position 58497490)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 58600618
GRCz11 6 58594849
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAATCTCATTGATTATAGAAGTGGATGCRCAGACTAATCGCATAAAGAGA[A/T]GATTTWTCTGCAAGTCTGTGATTCACTCYAACAGGAAATTTTCCTAYGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18418
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018498 Nonsense 1448 2507 10 21
Genomic Location (Zv9):
Chromosome 6 (position 58497934)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 58601062
GRCz11 6 58595293
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAAGTCAAGCTYATGAACTGAATAAGCAAGGTTTGATCCAGCACAACCCT[C/T]AGACYGACTCAGACACGTTCCCWGTGTTAAAATCAAWCCTCAGATGCCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15330
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018498 Nonsense 1589 2507 10 21
Genomic Location (Zv9):
Chromosome 6 (position 58498358)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 58601486
GRCz11 6 58595717
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGATCAACARTCGGCCTATGAGAGGAAGGCAAATGCTCTGCATTTYGCAT[T/A]AAARCTKTCAAGCCAAAGTGAAAGGAAGGTGGCTTATATTGTGGAGCTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20836
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018498 Nonsense 1948 2507 10 21
Genomic Location (Zv9):
Chromosome 6 (position 58499434)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 58602562
GRCz11 6 58596793
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCGAATTGATTTTCTGATTAATCACATGCCCATGACAAACATTCCAGAA[C/T]AAATATTCCACGAGAGGACGAGATTTACGCTGGAGCTGATTCCAAAGCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40812
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018498 Nonsense 2066 2507 13 21
Genomic Location (Zv9):
Chromosome 6 (position 58502183)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 58605311
GRCz11 6 58599542
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAACTGTTGTTGGTGTCCATATTTTGTACTGGCTGCACAAGAATATCCAA[C/T]AGCTCCAAGCTTCTGGTTCAAAGAAGAGAGCTATTCTGTACTGTGGCCCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8462
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018498 Essential Splice Site 2091 2507 13 21
Genomic Location (Zv9):
Chromosome 6 (position 58502262)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 58605390
GRCz11 6 58599621
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCTATTCTGTACTGTGGCCCGTCAAATAAATCTGTTGATGTTGTTGCAG[G/A]YAATGCAAAATTTTGTTTATAAAGCTTTTNTATWATTTGTATWCATGCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7054
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018498 Essential Splice Site 2092 2507 13 21
Genomic Location (Zv9):
Chromosome 6 (position 58502263)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 58605391
GRCz11 6 58599622
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTATTCTGTACTGTGGCCCGTCAAATAAATCTGTTGATGTTGTTGCAGG[T/C]AATGCAAAATTTTGTTTATAAAGCTTTTNTATTATTTGTATWCATGCATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20837
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018498 Nonsense 2200 2507 16 21
Genomic Location (Zv9):
Chromosome 6 (position 58509742)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 58612870
GRCz11 6 58607101
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCAAAAAGGCTCGAAAGCATGAATTATTGCACCATGACGTAATCTTATG[C/A]ACGTGCACCGCAGCTTCACATCCAGCACTGGCGGAAACCCTTGACTTTAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link